Transcript

si:ch73-329n5.6-002

ID
ZDB-TSCRIPT-131113-324
Name
si:ch73-329n5.6-002
Previous Names
  • ch73-329n5.6-002
Transcript Type
mRNA
Annotation Status
Withdrawn by Sanger
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000051869 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000051869|OTTDARG00000036434|ZDB-GENE-131121-171 si:ch73-329n5.6|OTTDARP00000040755 CH73-329N5.6-002 LG_ CU914622.9 Danio rerio protein_coding PUTATIVE, 885 bp
GGGTGTGTGACAGATGATGAGTCACTATAAATCACTCAGC
AAACAGAACTGTGGTCATAACATTGTGCTGGATTATGGTT
TCATTTGGATACACTGAAGTAGATGTTGTGCTGGGACATA
AAAATCAGTGAAACTTCCTCTTAAACTACAGCAGGTGAAA
GAGCAGCTGAGAAGAAAGGATAAGACCTTTTATATTTTGG
ATTTATTTCTGACTGCATCATCATGTTTCTGATTTCATCG
CATCTGCTGTTGTTCTTATCACTCCTGGCTCAATCCAGAG
CACAAACAACAATAGACACTACAGAAATCACCACTGAAAT
CCTCACGACCACAACCCCAGAGACCACCACTGAAATCCCC
ACAACCACAGCCACAGAAACCACCACTACAAACCCAGAGA
CCACCACCGAAATCACCAATACAACCCCAGATACCACCAC
TGAAACCACCACTGTAGACACCACTACAATTCCAGTAACC
ACCACAACCCCGGAGACCACCACAGAAACCACTACAGAAG
AGACCACCACCACTACCACCCCAGAAACCACTACAGAAGA
GACCACCACCACCACCCCAGAAACCACTACAGAAGAGACC
ACCACCACCACCCCAGAAACCACTACAGAAGAGACCACCA
CCACCACCCCAGAAACCACTACAGAAGAGACCACCACCAC
CCCAGAAACCACTACAGAAGACACCACCACCACTGAGAGC
ACCACCATTGCATCAACTACTGCATGGACAGCCCCGGCAA
TATTCTACCCATTCGGCTCAGCAGCAGGAGACACTGGATA
TACTGAAGTTGGCTATGAGTCCTATCAATATGTGACCTTC
TCTACTCCATTTACATTCTTTACCCGCAATTACAGCAGCA
TTTAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations