ZFIN ID: ZDB-TSCRIPT-131113-3225
Transcript Name: chd3-201
Previous Names: chd3-001, dkey-19b23.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000032833 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000032833|OTTDARG00000025008|ZDB-GENE-121031-4 chd3|OTTDARP00000026556 DKEY-19B23.4-001 LG_none CR318653.8,BX927371.12 Danio rerio protein_coding NOVEL, 8745 bp
TGTTTCTCTGCCTTGTAGTGTAAAATATTCCAAAACGCCC
CCCACTTTTTGTGTGTCGATTTGAATATTACATAAATATC
ATAATTTGGAAGGAATACACTTTTAGATCTCGCGGAACGG
GGTCACCGACGGGAATATAATGTCCTCTCTTCTCCGTTCT
TGTGAGGAAGATGAGGGCACGGCGGTTAATTCCGAGGGAG
GAGATTTTGATGAAGAAGAAGAAGACGACGGGGACCTGGA
CGAGAACGCAAGCGACATAAACTCACCGGCGGCGCCTCGA
GAAACTGCAGCAAGAGCCGCGCCAGATGATGGAGACGACA
TTGGCGAGGCATCGGACAGGGACAACCTGGGGAAAAAGAA
ACGAGGGCCTAAGAAAAAGAAAGAGACGAAGAAGAAAGAC
AAGGAGAAAGAGGGAAAGATCGCCAAAGCACGCAAGCGGA
AAAAAATTGAGAGTGACATAGAGAGAGACTCAGAGCCGGA
CTATGCCATGAACTCTGACAGTGCTGCCAGTGATTATGGA
GGGGAGAAGAAAAAGAAGAAGAAACACAAGGACAAGAAGG
AGAAGAAAACCAAGAAAAAGAAGAAAGAGGATGAAGACAG
CACGCATGAAGAGACCACGAAGCCGGTAGAGATGAAAACA
TCAGCCCAGCTGGCGAGAGAGTGGGGACTTGAGGATGTTG
ATCACACATTCACAGAAGAAGATTACCGCACGTTAACCAA
CTACAAAGCCTTCAGCCAGTTCCTCAGGCCCATGATTGCT
AAGAAGAACCCTAAAATCCCCATGTCCAAGATGATGACCA
TTCTTGGGGCCAAATGGCGGGAGTTCAGCTCCAATAATCC
ATTCAAGGGTTCGGCAGCAGCCGTCGCTGCAGCTGCTGCC
GCTGCGGCTGCAGCCGTTGCCGAGCAGGTCTCCGCAGCAA
CAGCCTCGCCCGAACCTCCACCTCAACCACCTCCACTACG
CAAGGCCAAGACCAAAGAGGGCAAAGGCCCTGGCTACAAG
AAACGAAGTAAGAGCCCTCGTGTCTCCGACAAGAAGAAGC
CAAAACCCAAGAAAATGGCTCCCCTGCGCATTAAACTGGG
AGCGATTGGTAACAAGAGGAAGAAGAGCAGTTCAAGTGAG
GAGGTGGATGAGGACGACTCTGAGCAGGAAAACTCCAGCG
TTCACAGTTCTTCAGTCCGCTCTGACAGCTCAGGACGGGT
CAAAAAGAATAAAAGGGGTCGCCCTGCCAAGAAGAAGAAA
AAGGCGCTGGGCGATGAGGATGGCGATGGCTATGAGACTG
ACCATCAGGATTACTGCGAGGTGTGTCAGCAGGGAGGAGA
GATCATTCTGTGTGATACCTGTCCCAGAGCTTATCACCTG
GTGTGCCTTGAACCTGAGCTGGAGAAAGCACCTGAGGGCA
AGTGGAGCTGCCCTCACTGCGAGAAAGAAGGGATCCAGTG
GGAAGCAAAAGAAGAAGACTTTGAGGAATTTGAAGAGGAG
TGTGACGATGTGCGGGATGTGGAGTCAGGGCTTGGTGGAG
AGGAAGAGGAGGATGACCACATGGAGTTCTGTCGAGTGTG
TAAAGACGGAGGAGAGCTGTTGTGTTGTGACTCCTGTCCG
TCATCTTATCACATTCACTGCCTGAATCCTCCACTGCCCG
AAATCCCCAATGGAGAATGGCTCTGTCCACGCTGCACTTG
TCCACCAATCAAAGGACGAGTGCAAAAAATCCTGCACTGG
CGATGGGGTGAACCTCCACCCCCAGTTCCCGTCCCTCCAC
CTCCAGACGCACCTCCTGATGCCCCGCCCCCTCCACCCAT
GAAGGGTCGTCCTGAGCGGGAATTCTTTGTGAAGCTGACG
GCACAGTCCTACTGGCACTGCACCTGGATTACTGAGCTAC
AGCTCGAGATCTTCCATTCGGTGATGTTCCGCAACTATCA
GAGGAAAACGGACATGGATGAGCCGCCCAGCCTTGACTAC
GGCTCTGGGGGAGAGGAGGATTCTGGGAAGAGTGAGAAGC
GGAGGGCTAAAGACCCCCAATACGCCATTCTAGAGGAGAA
GTACTACCGTTATGGAATAAAGCCAGAGTGGATGATGGTG
CACAGGATAATCAATCACAGTGTGGATAAGAAGGGCAACT
ACCACTATCTGGTTAAATGGAGAGACCTGACCTATGACCA
GTGCACCTGGGAGAGAGATGAGCTGGACATCCCTGAGTTT
GCTCTGCACAAAACGGCATACTGGAGACACAGGGAGGCAG
TGATGAAGGAAGATCCAGAGAAGCCTAGGAAGATGAGGAG
GAGAGAGGAGAACGATGAAGCTCCAAGCACGCCTGTTAAT
GATCCCACGATCAAGTATGAGGAGCAGCCAGAGTTTGTGA
CGGAGACAGGAGGAACGCTGCACCTCTACCAGCTGGAAGG
CCTGAACTGGCTGCGCTTCTCCTGGGCTCAGGGCACAGAC
ACCATCCTGGCTGATGAAATGGGTCTGGGCAAAACCATCC
AGACCATTGTATTCCTCTACTCCCTGTTTAAAGAGGGTCA
CACTAAAGGGCCGTTCCTGGTGAGCGCACCGCTGTCCACA
ATCATTAACTGGGAGAGAGAGTTTGAGATGTGGGCTCCTG
ACTTCTATGTTGTCACTTACACCGGAGACAAGGACAGCCG
GGCCATCATCCGCGAAAACGAGTTCACTTTTGATGACACG
GCTGTAAAGGGAGGAAAGAAAGCCTTCAAATTACGGAGAG
AAGCACCTATTAAGTTCCATGTTTTACTGACGTCATACGA
GCTTGTGACCATAGACCAGAACGTTCTTAAGTCCATTGAC
TGGGCTTGTCTTGTAGTGGATGAAGCTCACCGCCTCAAAA
ACAACCAGTCTAAGTTCTTCAGGAGACTGAACGACTACAA
GATAGACCATAAGCTGCTGCTAACAGGAACTCCACTCCAG
AACAACCTGGAAGAGCTTTTCCACCTGCTTAACTTCCTGA
CACCCAACCGCTTCAACAATCTGGAGGGTTTTCTAGAGGA
GTTTGCGGACATCTCTAAAGAGGACCAGATCAAGAAACTG
CATGACCTGCTCGGCCCTCACATGCTGCGGAGACTCAAAG
CTGATGTGTTTAAAAACATGCCAGCAAAAACGGAGCTGAT
CGTCCGAGTGGAGCTCAGCCCCATGCAGAAAAAATACTAC
AAGTTCATTCTGACGCGTAACTTCGAGGCGCTGAATTCCA
AGGGAGGAGGGAACCAGGTGTCTCTGCTCAACATTATGAT
GGACCTAAAAAAGTGCTGCAACCACCCCTACCTCTTCCCC
GTCGCTGCTGCCGAAGCTCCCAAGACACCGAGTGGAGCGT
ATGAAGGTGTTGGGCTTACCAAGGCCTCTGGGAAACTCAT
GCTGCTGCAGAAAATGCTCCGAAAACTGAAAGAACAAGGC
CACCGGGTGTTAGTGTTCTCTCAGATGACCAAGATGCTGG
ATTTGCTGGAGGACTTCCTGGATTCTGAGGGTTATAAATA
TGAGCGGATAGATGGAGGCATCACTGGAGCTCTCCGTCAG
GAAGCCATCGACAGATTCAATGCTCCTGGTGCGGTTCAGT
TTTGTTTTCTCCTCTCTACGCGAGCGGGTGGTCTGGGCAT
CAACTTGGCCACTGCGGACACAGTCATCATCTTTGACTCG
GACTGGAATCCTCATAATGACATACAGGCCTTCAGTCGAG
CTCACCGCATCGGTCAGGCCAATAAGGTGATGATATACCG
CTTTGTGACTCGAGCTTCAGTTGAGGAGCGAATCACGCAG
GTGGCCAAAAGAAAGATGATGCTCACACACCTGGTGGTGC
GGCCCGGATTGGGCTCAAAAGCAGGATCCATGTCCAAACA
AGAGCTGGACGACATCCTCAAGTTTGGCACAGAGGAGCTT
TTCAAAGATGAGATTGAGGCAGGGGACAATAAAGATGATG
ATATGAGTGTAATACACTACGATAATGCAGCCATCGAGCG
TCTGCTGGACCGCAGTCAGGATGCCACCGACGACTCTGAC
ATGCAGAACATGAACGAGTATCTGAGCTCCTTCAAGGTGG
CCCAGTACACTGTCAAAGAGGATGACAAGATAGAGGAAAT
TGAGAGAGAAATCATTAAGCAGGAAGAGAATGTGGATCCT
GATTATTGGGAGAAACTCCTGAGGCATCACTACGAGCAGC
AGCAGGAGGATCTGGCCCGCAATCTCGGCAAAGGAAAGAG
AGTTCGCAAACAGGTCAACTACAATGATGCAGCTCAAGAG
GACCAAGAGTGGCATGCTGACATTTCAGATAACCAATCAG
AGTACTCTGTTGGCTCGGAGGAGGAAGATGAAGACTTTGA
CGAGAGACCTGAGGGTCGCAGACAGTCACGCAGGCAACTT
CGAAACGAGAAGGACAAACCACTGCCACCCCTTTTGGCCA
GAGTTGGCGGCAACATTGAGGTATTGGGCTTTAATACGCG
TCAGAGAAAAGCCTTCCTGAATGCCATCATGAGATGGGGG
ATGCCTGCTCAGGACGCCTTCTCTTCTCAGTGGCTCGTGC
GGGACCTCCGCGGCAAGAGCGAGAAAGAGTTCAAGGCATA
TGTGTCGCTCTTCATGAGGCATCTCTGTGAGCCAGTGGCT
GATGGTTCCGAGACGTTTGCTGATGGCGTCCCACGGGAGG
GGCTCTGCAGGCAGCCGGTCCTCACACGTATAGGAGTCAT
GTCTCTGGTCAAGAAGAAGGTGCAAGAGTTTGAACATATC
AATGGGAAATGGAGCATGCCTGAGCTGAAGCCAGAGATCA
CCGTTGACTCTAAGAAATCCTCAAGAGCCTCTTCGCCCAC
CATCAAGACAGACACTCCCACACCTGAACTGAGCTGCAAC
AACACACCCTGCACCTCCAAACCAGCCACCCCCTCTCCAC
CTGACAAGACGGAGAAGAGCGCAAAAGAGGCAGAGAAAGA
TGAGGCCGAGTCCCTGACAGAACCAGAGAGAGAGCGAGAG
AAGGAAAAAGCGAAAGAAGCAAAGGAGGGAGAGAGTGTGG
AGAGCACAGAACACGGAGAAGCTACAGGGAACGAGGGTGA
GAAAGATCCAATAACCAGTGAAAAATCTCAGACATCTGAA
AGTCCAGCAGCGGCAGCTTCTGATGACTCAAAAACTAAAG
AAAATCCTGACATCTCTCAGTCTCCACCAAAAGAAAAGAA
TGAGAAGGAGAAACAAGAGGAGGAGGAGGGCAAGGAAAAA
GAGCCCTCCACCGAGAAACCGTCTGATTCTCCATCTGTTA
AAGAAGAGAGCAAAGAGGCTCTGAAAGGTGACAAAAAAGA
AAAGGCTGGAGAAGAGAAGGAGAAAACTGAAGCATCGTCC
CCTCCCTCAGAAACAACAGAGAAGAAGGACAAATTAGATC
AGTCGTCTGAGGTCAAAAAAGAGGAGGTGAAGGGTGAAAG
GGATGCTGGGAAGGAGGTCAGAGTGCAGAGGGAGGAGGTG
CCCAAAGTTATCAGCAGACCAGCAGAGCGTCCACGGTTCA
TGTTCAACATCGCAGATGGAGGATTCACAGAGCTCCACAC
TCTCTGGCAGAATGAGGAGCGGGCAGCTATTTCATCAGGC
AAGATCAACGAGATCTGGCACCGGCGGCACGACTTCTGGC
TGCTTTCAGGAATCGTGTGTCATGGCTACGCACGGTGGCA
GGACATTCAGAATGACCCGCAGTTTGCAATCATAAATGAA
CCCTTCAAAACTCAAGCCAACAAAGGAAACTTCTTAGAGA
TGAAAAACAAGTTCCTGGCAAGACGGTTCAAGTTGCTGGA
GCAGGCCCTGGTAATCGAGGAGCAGCTGCGTCGGGCTGCC
TACCTCAACATGACCCAGGACCCCACTCACCCGGCCATGG
CCTTGAACGCCCGCTTTGCTGAGGTCGAATGTCTCGCTGA
ATCCCATCAGCATCTCAGCAAGGAGTCGCTCGCAGGAAAC
AAACCTGCCAATGCCGTCTTGCACAAGGTGCTAAACCAGT
TGGAGGAGCTTCTGAGTGACATGAAGGCAGACGTAACGCG
GCTCCCAGCCACACTGTCCAGAGTCCCGCCGATCACAGCC
CGTCTGCAGATGTCCGAGAGAAGCATCCTCAGTAGACTGG
CCAACAAGGGCAACGAGACACACACACCGCCGCCTATTCC
TCCAGGCCCGTACGCCACCCCGCAGAACTTCGGCCCTCCC
TTCACACCTGCACCCTCAGCTGCCCTCGCTCTGGCCGGAG
CAAACTACAGCCAGATGCCACCCGGATCCTTCATATCAGT
GTTGAACGGGCCGCCCATGTCGGTGAAGAAAGAGAGGGAG
GCCGAGCTCCTGATGGCACGGAGGGAACAGCGCAGTGGGG
AGGTGATCTGCATCGATGACTGAATTCAGCAACTCACACA
CACAAACACACACACACACACATGCTGACTCAGTCAAAGG
ACATTTGCATGCAAACACAAACACAACTATTCCTGAACAC
ACACACACACACACACACACATATGCACCTGCAGTTTGAC
GAATGAACAGACTACCCTCAGTATCACGGCAGCACTTTCA
CAAACAGCTACGCAGAGCTTCAGCTCGCCCTTTGGTTATT
TCCTCTCGAACACCTATGTGCACATACACACACACATGCA
CACATACAAAATATTTGATTTCCTTTCCTCTCATAACTAT
CAGCCTCACATTTCAGAGGAATCCACACGCTCATGCTCAT
CTGAAGTCCCGTGCCCTCACTAGTGCCCCACGACACAGAC
ATGAAGCTGCATGTATGTGGAAGAGCTTCATATCACCCGC
AGTGATTTGTTTTCCAACAGCATGCATCTCGCAGTCCACG
GTTCAGTCAAGAGAAAACGCCTGTGCCCGCTCTTGCATAG
TGCAATCTTTCAAGAAATCCCTCATCGCAAGCTAGCGTGA
CTGTTTCGGAGCTGCCATGTCCCATAAACAAGCTTCAAGC
AGTCTTCTTAAAGGGAGTGTTCAGCCTAAAAGATTCCTGT
CATCATTTAGCCATCCTCAAGTTCTTCCAAATCTTCCCTT
GTTCTGTTGAGAATTGAAGAACGCTCGCAACTACTAAACT
ATCAACATATAGCCATTGATTTTCATTGTGTTTTCCTCCT
ACTGTGAAAATGAATGGCTATACTGTAGCATTCTTCAAAA
TGTGTTCAACGGAAGAAAAAAAAACTCTAATTTATTACAT
GTTTTGTCTGTATAATGAATGTATCTACACAATGAATATA
ATGGGCATTGTTGCATCCCATTGATGTTCATTTAATGGTC
AAAAAACACATAGAATATATTTTGTGTGAAAGTCAACCAT
GTGTGGAATGACATTGAGTGAATGATGGCTGAAATTTCAT
TTTAGGTGAACTGGCCCTTTAAGAATGTGGGCTTTCAGCA
TGGTGGTGATTTAGTTTGGGAGGATATATATGTATTTTAC
TGTAAAAAATATGGGGGGGGGGGGGGGGTATTAAACATTA
CCCTGGCCAACTTTGAGAAAAAAAAAAAACGAGGTAAAAT
TTATGACCTACCACGACAGTAAAGAAGTAATGTATTATGT
TCAATTCAATCAGTATTGGCTGCAGTATTGTCTTGCGCTA
AAAAGACAGTATGTAATGAAGTTTATTTCGCCTTATATTG
GGATATCGAGCATTGAAATGTAAAGTTCCCTGCCTTTTTT
AAAGTATTGACCCTTAATCTAGTGTTACAGTGGGGTGAAG
AGGGTTCAAAAGCATCTTCGTACCTCCCCAAGTGTTATCG
AAGCACGTTCAGCAGTTCTACACTTCATTCTCTCTCATCA
CTTCATCCTCACCTTTCTCATTCAAACCAATTGCTCACAT
CTCACTCCTATCCTTTATTCAAATTTCTACTTGTTTTTAC
GAGCTCTTTGATATCGTTTGCGTATTTAAACTCGGTTTCA
TTGTGTTCTCCTGTTTTTAATCCTTGTTATTACAACTAAG
ATTATTGTTGTTGCTCTTGATGTTGTCCTTGATGTTACAT
TTGCGAAGCTTCTACCAAATGAAAATAATAATAATAATAA
AAAACAGTCGAAACATTGACGCATTGTATGTTTGGTCCAT
CACATTTCTCTATATCGGACCTCTTGTAAAAGAATATTCC
ACAAAGGGGTCGAAAGGACTTGGGAATAATCGATATCATC
GCTATCCTACAGACTTCGCTTATATCTACAGTAGATTCGG
GGCTTGCAAACAAATAACCTGTATGCAGTGGATCACATGT
AACCAGGAAATTGAAAACATATGAATGCATATATTCAAAT
CTGCAATTGAAATTCCTTCTGCAATGTTTCTTTGGCTCCT
ACAAAAGTAAAGCCTTGTAATGTTACCGCCTTAAATGGTA
ATACAGCTGTAAAGCGTTAATGAGCAGATGTGAACTCTGT
ATATGGCTGCGGTTGCACTATACCTAGCTAGGCCTCAACT
CAAGACAGATCATGAGTTAAAATGTTAATTTATTTGCCCC
GTTCCCCAGTATAGTTCTGAAATATCGTTCATTTCAGTGC
TTGGTTTTATTTGGGAGAGTTGCGTCAAATCAAGCACTTT
CTGTCCTTTTTTTCATTTCTGTCTTTTAACGTTTTTTTTT
TGTTGTTGTCAGTATTTTCTGCATTTTCTTGCTAAGAGTC
ACTGTGTACATTGTGTGATTCCAGACAGTCAGTGACATTG
TTGTGATCAACATTTGGCACACCGAACGGAACATGTTAAT
AATGCATCTTTCTCTCTTTTGTTTTGTTTTGTTTGTAATA
AAATAAAATAAAAAACAAATAAATG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
chd3-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000032833 (1),  Ensembl_Trans:ENSDART00000156717 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC127572 (1) 1422 nt
GenBank:BC127574 (1) 1422 nt
GenBank:CA475219 (1) 909 nt
GenBank:CK238783 (1) 735 nt
GenBank:EB916717 (1) 680 nt
GenBank:EB897725 (1) 663 nt
GenBank:DT871924 (1) 593 nt
GenBank:BC142760 (1) 573 nt
GenBank:AL914691 (1) 538 nt
GenBank:CD283110 (1) 537 nt
GenBank:AL914690 (1) 536 nt
GenBank:EB895146 (1) 503 nt
GenBank:EB916100 (1) 465 nt
GenBank:BI841735 (1) 380 nt
CITATIONS (2)