ZFIN ID: ZDB-TSCRIPT-131113-3197
Transcript Name: pdlim2-202
Previous Name: pdlim2-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000060094 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000060094|OTTDARG00000028239|ZDB-GENE-070308-4 pdlim2|OTTDARP00000046486 pdlim2-002 LG_none CR855861.11,BX649451.4 Danio rerio protein_coding KNOWN, 713 bp
CTCAACAAAGGTGTGTGTGTGTGCACTCCCTCCTGTGTGG
CTGTGTGTATATGTGTGCAGTTGTCACCGTAGGCTCTGTT
GTTGTTCCAACAAGAGATGAACTAGTTGGATAGGAATTTG
CCTTTGTTTGCTCTTGAGCTCAGATTTTGCCATGCAGAAG
TTTGACCGAGACTCGGAAGTATACAAGATGATTCAGGAGA
ACAAAGAATCTCGTGCGGCTCCCCGGCAATCCAACACCTT
CAAAATGCTACAGGAGGTGCTGGAGGCTGATGAGAAAGAG
GCTGCTTTGCGGTTTCCAAGCAAGTTGTCACCAAACCCCC
CTAAGACATCCTCTGTTGCTGGTGTGCAGAAACATCACAC
TTGTGAAAAATGTGGCACCAGCATTGTCACTCAGGCTGTG
AAGATTACAGACAATTGCTATCGTCACCCAGAATGCTACA
CCTGTACAGAATGCGGGCTCAACCTAAAGATGCGGGGCCA
CTTCTGGGCGGAGGACAAAATGTTCTGCGAGAAACATGCC
AGAGAAAGATACCAGGGTCCTGGCAGTAGCCCTCACTCGG
TTGTGTCCCCACACCACTGAAAAGTATAGTTCCCCACCTT
TAACTCCTCTGCTTGGCAGGAAGCACAGAAAGGAGATGAT
GATGAAATCATTGTTACATTGTCCATTGGGATCCAAAACA
GTATGTCTTAAAATCACTTGAAACTTTGGGACT

pdlim2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA pdlim2-201 (1)    Ensembl 2727
pdlim2-202 713
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pdlim2-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000060094 (1),  Ensembl_Trans:ENSDART00000155189 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BI887676 (1) 723 nt
CITATIONS (2)