Transcript

inppl1a-203

ID
ZDB-TSCRIPT-131113-2897
Name
inppl1a-203
Previous Names
  • inppl1a-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057935 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057935|OTTDARG00000040375|ZDB-GENE-030131-3904 inppl1a|OTTDARP00000045371 inppl1a-002 LG_ FP929031.11 Danio rerio protein_coding NOVEL, 781 bp
GAACTCTTCCTCCTCGATCATCACATGATTATGTAAAAGG
CAAGCAGGATCCATTTGAGAGCGACGCCACAACATGCAAA
AACAGCTTCAATAACCCCGCCTACTACATTCTAGAAGGCG
TCCCCAACCAATCAGCTGCTCTGGCTTCTGATATACTCCC
AGGCTCCGCCCTCCCTCCGCTGGCCAATAAGACGACGGCT
CCCCCTGCTGGCAGTGTGGGGAAGAGCAAACCTCCCAGTG
GAAGCTCCGCCCAGGGCCGCTGGCAGACATCTGGACGCTC
GGTTCGACCAATCAGTGAAGAGGGCTCATCAGAGGATGAT
GGGAATATTGGACCCCACGCTGGCTCGCTGAACCGCCCCC
CACCGGATTTCCCTCCACCGCCACTGCCCAAGGCTGCTCT
GGAGATGTCAGAAAACTCATTCGGGAAACCGCGGGTATTT
TCAGATCTCGCTGACGGTAAAATCCCCCCGCCGTCCAAAC
CATTGGTGTCTCCCGGCTTGACTCCACCCCCAGGAGGAGC
CCCAGGAGGAGGCGTGGCCTTCTGTATAGAGTCTCCACCT
GTGTTGAGTCCAAACTCCGCCCCTTTCCGTAGAGGGGGCG
GCGCCTCAGCGCTGGATGATCAGTCGTGTTCGGTGCTCCA
GATGGCCAAAACCCTGAGTGAGGTGGAGTATCCATCGGGC
AGGGAGCGCGGGGCCTCACAGGGGCCGACAGGGCCACAGC
TGAGGGGTCTGAGCTTCCCTTCACATCCCATCCAGGAGGA
GAGCATCGCTGAGGACCTGCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations