Transcript

col4a4-201

ID
ZDB-TSCRIPT-131113-2853
Name
col4a4-201
Previous Names
  • col4a4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000057696 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057696|OTTDARG00000040201|ZDB-GENE-101001-1 col4a4|OTTDARP00000045202 col4a4-001 LG_none CT027718.4,CU469538.6,BX571880.6 Danio rerio protein_coding NOVEL, 10607 bp
TACCCCTTTACTTTGCGTCGGTGTCAGAAGTCCCAGCAGC
ATCATTCCGACAAGTGTCACGCGCAATAATACCCAATGAT
CCATTGTTTTTCACTGGGAAGAGAACCCGTGCGCAATTGC
AGTCCAAAACTATCTCGGAATCACGCGTAATTCAGGCGTC
CTGAATGGAAGACCAATCTCTCCAAATCCACCTCCAATAG
CACCTGCAGTGCTGCGAGCATGTCAGATATAACACTTAAA
CTTATGCTCAAGAAACGGACGCTTTTTGGACGGTCAGTGA
ATCCATAAGAGTATGAAATCAGCGGGCTTTCAACAGCGTA
GTGAGTTGGAAGTCCCACTGTTTGTAGTTGGGATAGGTAA
AGCCTCATCTCTCATCTTGACGTCATGCAAACACGGAGCC
GCAGCGGGCACCAGTTTTCAGTTGTCTCTTCCGTTGCACT
GGATACTGTGTCATGTGTTCAGGCTTTAAGTTCGGCGTCC
TGCTAAAGTTCTCGTTAATGTAAAGCCGCAGTAGCGCAGG
AAACTACGAGAGCAGGTGGGAGAGTTGTCCATCGGGACGT
CCAGAGTCGTAGCTGACCACACCGTTCATTGACAGTGGAG
AAATATCAACAGGTATCACATGCCCTGAGTGGCGGCTGAG
ATGACACGCCCCCACCGAATCGCCTCGACCAACCTCTTTT
TCTGCAGGAGGCTTTTATTGGCACTTTTGATGATACAAAC
AACTTTGGGGGGGGACAAGACAGAAGAGTGTGGAGGTCGA
GACTGCAGCGTCTGCCAGTGTTTCCCCCCGAAAGGAGAGC
AGGGGAATCCTGGTATGTTGGGTCGACAGGGCCCCCAGGG
GCCCCAAGGTTCTCCTGGCCCCCCTGGACTTCGTGGTGAT
AAGGGTGAACGAGGAACAATAGGGTTCCCTGGGGTGTCCG
GTCCAAAGGGAGAACTGGGTGCTCGAGGAGTTGAAGGCCA
TGCTGGATTAGATGGAGTGCCTGGCCATCCTGGGCCTGGT
GGTCTTCCTGGGCTTCCCGGGAAGGATGGCTGTAATGGAA
CCAAAGGGGAATGTGGGCTGAATGGTGAGGTGGGACGCCC
CGGCCTTCCAGGACCTGTGGGACTGCCTGGGTTCAAAGGG
GCCAAAGGAGAACCGTTTTATAGGACGATTTATCTACCTG
GAAAACCTGGTGCCGACGGACCACCAGGAATGGTTGGACC
ACAAGGACTTCAAGGCATTGCTGGCCCAAAAGGTCCTCCA
GGATGGGTGGGATCTGACGGCCCTAAAGGTAAACCAGGTC
TTAAAGGTCCAAGAGGGCCACCGGGAGACCCGGGTAGATC
ACTGGCAGGACCAAAAGGAGATGAGGGTGATCAGGGTATT
CAGGGTGATCCAGGTCCATTTGAATATGTGGAGCCCAACC
CAGAAGACTACATAAAAGGAGAAAAGGGGGAACAGGGACC
AAGAGGGTATATTGGAATACCTGGTCAGGAAGGTCCTGAA
GGGCCTTCAGCAGAAAAAGGAGAGAAAGGAGTGATTGGGC
TGCCTGGAGTCAGAGGTCCACCTGGATATCCAGGCCAAAC
AGGGCGTCAAGGACCTAAGGCTGAACGTGGTGTGAATGGT
CTCCCTGGTCTCTATGGCACCAAAGGGCTGATGGGCATCC
CGGGTGACCCTGGGCCTAAAGGAAAACCGGTGGAATCTCA
AAAATATGTGATAGGACTACCTGGAGATCCTGGACCACCG
GGAAATCCTGGAGCACCTGGTGACAGAGGGTTGATGGGTA
TACCTGGACCTTCTGGTGATCCAGGACTATCTTTACCAGG
TGCAATGGGTGACACTGGTTTAATGGGTCTCAGTGGACTC
AAAGGACAAAAAGGTGGCGCTGGAAGCATATATGGGTCAC
TCTTGAGCTACGGGGAACCTGGAAAACGGGGTTTTCCTGG
ACCTAAAGGACAAAAAGGAAATCCTGGCACTCCTGGTTAT
TACTGCCTTCCTGGTGAACGTGGAGATCTTGGACGAAAAG
GAGAAAGAGGGATTGTCGGATATAAAGGTGTCCAGGGGAG
AAAAGGTCCTGATGGAGGATGTGCATGTGATCCTCCTGGT
GATCTTCCTGGGGATCCAGGCCCTCCAGGCCCTCCGGGTG
AACCTGGTGATCCCGGGCAGAAAGGTTTCAGAGGCCCCCT
TGGTGAAATTGGACTCAGTGGAGACAATGGTGTGAATGGG
ATAACTGGTTCCAGAGGCTTAACAGGTCCCAGAGGAGTGA
AAGGAAAGAAAGGAGAGGTTATGACGTTAAGCATAAAAGG
GGAGAAAGGTGATCTGGGTCCTTCTGGACAGCATGGAAAA
CAAGGGTATACTGGGAAATCGGGGGTTGATGGGATAGATG
GCGACCCTGGAGATCCTGGACCTTTGGGAGATGATCTCTT
TGGTCCACCAGGTGACAGAGGGTGTCAGGGCGCTATTGGT
GTGAAAGGTGTCAGGGGTCAGACTGGACCTCCTGGTGGAT
GTATTATGGGGTCAATCGGGCGACGGGGGCAACAAGGAGA
CCCCGGACCTCAAGGCCTGGCGGGATTCCCTGGCCCTAAA
GGGCTTCAAGGTGAAACTCTGCCCTGTGGACCTGGCATAC
CTGGACCCCGTGGTTGCAAAGGGATGCCTGGTGGTATAGG
TGACAAAGGTAAGCTTGGAAATCCAGGCTGCATAGGACAA
AACGGAACAAGGGGACCCAAGGGAGAAATAGGAGAACCTG
GGGATTGTGGAATCACTGGACAAAGAGGTCCAGATGGCTA
TTTAGGAGATCCAGGTGAACCCGGGCCCTGCGGCATCAGT
ATTAATGGCTCACCTGGAATACCTGGCAGTCGTGGACCCG
AGGGTCTGAAAGGCTCTTGTGGAGACCGTATGTTTGGGGC
TCCAGGGCCGCTGGGGCCCTCTGGGGTTCAGGGATGTCAG
GGCCCTAAAGGTGTCCCAGGACCTCCAGGACCTATTGGAT
TGCAAGGTATGTCTGGTGTTCCAGGGTATCCTGGTAGAAA
AGGGGAAAGGGGGAAGGATGGTGCACCAGGACCACCTGGA
CGCCCAGGTAAGAGTCCAGAGCAGTGCGATAAAGGAGATG
AGGGTCTGCCTGGCAAGAAAGGAGAACAAGGCTTAATTGG
ACATAGAGGCTACCCTGGAGAGAAGGGGTCACTTGGGGAG
CTGGGATGTCCTGGCATTGGAGCCAAAGGAGCCCGGGGTA
AACCTGGTACTCCTGGACCCCAAGGATGCATAGGCCTTCA
GGGACCCGCAGGAGTCAACGGTGACGGTGGAAATCCTGGA
TATCCTGGACCAAAGGGTTTGCCTGGACCATGTGGACAAA
ACGGCTGTCCTGGAAACATCGGGCAGACGGGCTGTTTAGG
GCCTCCTGGACCGAAAGGCTTAAAGGGCCTCAATGGATGT
TCAGGCTTCCCTGGATTTAACGGAACCAAGGGCCAGAAAG
GATGCGTTGGGCCTCCAGGTTTTCCAGGAGACTTGTTTTA
TCACCCTGTGAAAGGAGAAATAGGACCACCTGGACCCAAT
GGGGAGAATGGTTTCTGTGGAGAAAGAGGTGATAAAGGTG
ATCCAGGTCCACCGGGAACACCGGGGTATCCGGGTCTGAA
TGGACCTCCAGGCTTTGAAAGGGGCTGTCGTGGACCGCCA
GGCGCTCGTGGGGTGCCTGGTGAGCCTGGAGTACGTGGAC
CACATGGGCCAAAGGGAATTGTGGGATTCCCAGGGGAAAA
TGGTGATAATGGCGATCCTGGATTGAGCGGCATGCCAGGA
ACTCCTGGTTATCGTGGATATGATGGTCCTAAAGGCGACA
GTGGTGAATCTATTTGTACGCCAGGGCGAACAGGTGAGAG
AGGGCCATGTGGAGACAATGGTGTGCCAGGTCCCTGTGGG
GAGAGAGGAGACAATGGTGACATTGGACCAGCAGGTCCAG
ATGGAAACTGTGGCCCTCCTGGGCCACCCGGGATCAATGG
TCATATTGGACCTCCAGGAGTGGTTGGGCCCCCAGGTACA
TGTGGTAGACATGGTCTAGAAGGACCTCCGGGGCCTCCAG
GTCCGCCGGGTAGTAATGGCAATGAAGGATGCACTGGCCT
TCGAGGACCTCCGGGGCCCCCAGGGCTTCATGGGCTGGAC
GGTCTAAAGGGTGTCAAGGGTGAGATTGGATCTCGAGGGC
TGGGTTCCACAGGTGAAAGAGGTGATCAAGGGCCAGAGGG
AGACAAAGGTGATCAAGGGGACCCGGGGTCACGAGGCCCT
TCACAAACAGGTGTTCGAGGTCCGAAAGGACCGCAGGGAC
TGCAAGGAGATCCTGGTCCAATGGGTCCTCCAGGCATTGT
GGGTGAAGAATGTAGGGTTCCAATGCCTGGACTTGGTGGA
GAACGGGGTTTCCCTGGGCTGGATGGACCTCCAGGGCCCA
TGGGGTTAATGGGGGATCCAGGCAATGCTTTTACAGTGTG
TGGTGAATGTGGTGATCCGGGTGGTCCTGGGTCACTTGGG
TTTAAAGGAGAGAAAGGATGCCATGGGTCTGGTGGCACCC
CGGGGTGTCAAGGCCCACAAGGCCCAAAAGGTGAAAAGGG
GCTGTGTGGACTTATGGGAATCCCGGGACTCCCTGGCCCT
ATGGGTGACTGTGGGCCTCTGGGTCCCAGTGGTGCAAAAG
GAGATAAAGGGGACACAGGTCCAAAAGGAGACCCTGGCAA
TGTCATAAAACCCACTACTTGTCCTCCTCCTCAGGGCCCT
CCTGGTGATCCAGGTCCACCGGGACAGATCGGTGAAGTGG
GTAAAAATGGAGATAATGGCAGTGGGGGTCCAAAAGGTGA
GAAGGGGGAAAGAGGAATCATTGGGATTTTTGGACAAACT
GGGCCCCCAGGAGAAGATGGACCTCTTGGAAACCCTGGAG
ATCAAGGTGAAAGAGGACCAGCTGGCTTTAAGGGACCTCC
GGGACCAGATGGTGATCGAGGTCCCCCTGGAAGAAATGAG
ACACTTTCTACAGGCTTTCTTCTAGTGATGCACAGCCAGT
CCCGCTATGTGCCGACTTGTCCTGCAGGCCTTACACAGTT
GTGGAACGGCTACAGTCTGCTTTACCTGGAGGGTCAGGAG
AGAGCACACACACAAGATCTGGGCCAGGCAGGTTCGTGTT
TGCCAGTGTTCAGCACGATGCCGTTCTCCTGTTGTAATAT
GGACACTTGTGATTACGCCAGCCGCAATGACAAATCCTAT
TGGCTGTCTACAAATGCCCCCATTCCTAATAAGCCTCTGA
AAGGGCAGGATATCGAGGAACACATCAGCAGGTGTGTGGT
GTGTGAAGCTCCAACACCAACCATTGCAATACACAGTCAA
GACCGTCTTGACCCAGTGTGTCCACCCAAATGGAGGAGCC
TCTGGACCGGATTTTCATTCATGATGTATACGGGGTCAGG
GGATGAAGGCGGTGGACAGTCTCTGACATCAACAGGAAGC
TGTTTGCAAGACTTCCGCAGTCAGCCATTTGTGGAGTGCC
AAGGTCCCCGTGGCACATGCAGTTATTTCGCCAGCATCTA
CAGTTTCTGGATGACTATAGACATGGAGCACAATGACTCC
AGTCCTCACGGTCCTGTGATCACAGAGGAAAGGCAGCAGC
GCGACAGCACCAGCAGATGCAGCATCTGCATGATGAATGA
CCCCAACCAATGATACAAGCCAATGGTATTTTCTAAACTG
CACTGAGAATGCACATCAACACATCACTTGTTGTTTGAGT
GATTGAGATGCTTTTTGGTCACTTTGTTTTTGGAGAGGAC
AAGAATGAACATTATTTGTGACCATTGAACTACACAGCTG
TGAACTTTTTACTTCATGGGATTTGTTCCAACATAACCTC
TTTACACAGCACGCATCTTTGCTTCTTGTCTTTGATTTCA
TTTTGGTGCTAGAAAATCCAATATCGTTTGCACATATTCC
TCTTTAAAAGATTTCCATTTTCTCCCTGGTTGTTATGTGT
TTGTGCACATCAAAGCATCTCATTGAAGATGTGGAATATT
GTAATGCTAGTTTTTTGTCTACGGTGCCATCTTTAACCAA
AACTGAACCATGTCGGTATACTTCTTTAGAGAGTAACATT
CATGTTTCAGAAGCGAAACTCCATTCATTTTCTCCATATG
GAAAGTCAGATCTTTTGAGACTTCGGTATTGTACATACAC
TTTCCTCTTTGCATTAAAGGGATATTTCACCTACAATAGT
AATTTAACTCATCATTTACTCTCCCTTGTGTGGTTTTTGA
ACACAAAAAAAGATATTTTGAAGAAATTGGTTGCTGACTG
GCTTTCACAACATTAAAACAATTTACTATGGAGGTAGGGT
TCGGTGATGTCGACCAAATTGGCATCCTACGATGTCTAAT
GTGAAACATCGCAATGAACGATGGCAACATCGTTATAGGC
AGCGGTGAATTAATTATTAATGACTAATTACTTCATAACA
AATTAATTATTTGTAGTCTACCGTTTAAATATCTGACACG
CATGGTCTTTGTTTACCCATAACCAAATCATAAATAAATT
AAGTTACACACAAATTACCACACTACCACACTTTTACCGC
GAAACTATGAATAGGCAGAGTGATCTGTGTCATTATAATG
GCATCGACAAACTTGGTTGGTAAAAACAGTATCTGAGGTT
TTCACTAAAATTCCTAAGTACAAGCGTGAAAGCGAAAGAT
TGAAGAAGTGTACTGATGCTGTGACACGTTACCGGATAGA
TTCAAAAGACAGAAGAGTCAATAGATAGTGACAAGATTAA
TTAAATATTATGTTTAACAATTATAATGAGGCGCAATCCA
GTGAAAGATCCTTGCTAAACTGTCAGACTTGCACTGCTCT
CTGGGGTTTTGTGCTCAAAGCACCCGCTGACTGCTGGAGC
TCAGACGAGTGCATGACTCTGTGTGTGTGTGTTTGTGTGT
GTGTGTGGTCATGTGATGTGGGTTTTCAGCGGTATCCGCT
TGTTAAATGTGACGTCACGCAAAGCGGTTTCCGGTTCCAA
ACGCTCTTTTTTCAACTGTATGGGGAGACTCATGAAATGG
TATTTATAAACGTTTACAAAGCGATTTAATACTTTCGAAA
ATCACGATCGCAGATTGTTGCGTACACTATGACTTTATAT
AAAATTAACTTTAATGTGTGATATGAATTGAAAGATCATA
AACAAATAATTTCTCAACTCAAATGAGTGGCAGCTTGGAC
ACGGAAAAAGTATTACATACGTCACCAACACGTCATCACT
TAACAAGCGGATAGTGTAGAGGTAGGGCTTTTTAGAAATG
CTAGATGAAACGCCAGTGTGGACGTGGATCATTTTCATTC
TAAAATGGCATTTTAAAATTACGGCGTTTGAGTGTAAACG
GCACCTGAGTGTGTATTTTTCATGAGCGGGTTTGTGACAG
GGGCGGGACGGAGCATCGCGATGCCAGCTCAGCATCGTGA
TGTCTATCGGCCATCAGCGATGGATGATGGCATCGTCTAT
CGACCCAACCCTATTGAACCTATTCTTCAATGCGGAAGTG
CGCTCTTTTTTGCGACTGTTTTAGAACTTCCGCTTCAGTC
GCCTATAGGAGAAATGACTAGGAATAAAAAATGGTAGAAA
ATGATCACACTACTTGCTCAACAAACAAGTGTGTTCATGA
CTATACAGACAAAGCAGAATAATATAATAAGAAAATTTCA
GTTTGCAACATCAAGCAGAAGAACGAGCTGTTTTTATGTC
TAAAAAATAATGGAAGTTGATTATACCGGAAGTCTCGAGC
GAAAAAGATTAAAATGGCTGCTCCCGCTCGTACGTGAAGA
ATAAGCTGAATATGGAAGTCAATGTGTCTTAGCAACCAGC
ATTCTTCAAAATATCTTCCTTTGTGTTCAACAGAAGATAG
AAACTCAAACTGGTTTTGAACAAGTGAGGGGTAGGTAAAC
TATGATACAATTACTTTTTTAGGTGAACAACCCCTTTAAC
TTATTTTGAGACTTATTATTTAATGTAAGAATTAATGCAG
AAAACTACATTTCCCATGATGCTTTAAAGAGGCATCTAAT
TAATCAAAGAGTCATATGCATTCTTGCAATGATCTTAAAA
TATGTTATGTAGATACTACCAACAATTTTTATTTTTTTTT
TTGCAATATTTCATAGGATTGTAATTCTTTCCCATAAAGC
ATTTCTTATTTTTTTTCCTTTTGTCTGATTTTAACAGACA
AATTAAAGTTTGTAATGTTGTGATTCTCCTCATTGGTTGG
TTTTCACATTCACATAGATGAAAGATTTTATGAAGAAAAG
TAATGGGAAAAATACATCTGGGAGTAAAGTTTTCTTCATT
TCAAGTGCATAGATTTTAATTCTTTAGTTGAAATCAAGTA
TTTTAAGCAGTAACTTCACCTAAAAATGAACATTCTGTCA
TCATTTACTCATTTCTTTCTACACAATACTGAAGAATGTT
GGAGGAAAACAGCCATTGACTTCTATAGGATTTTTGTTAC
TATTTTTAATAGCTGTTTCCCCCCAATATTCCCTTTAGAA
TAGTTCATTTGGTGTTCAACAGAGGAGAGTAATTCATAAA
AGTTTAGAACCAGCGTGCGAGTAAATTTTTGTTTTGGGGT
AAACTATCCCTTTAAGGTACGGCCATTTTCCGCGTAAAAT
GCTGTCACTGTGTTAAGAATCCACAAAATTGGGAAATTAG
CATGAAGGTAAAAAGACTTTCCATAAATGTTACACAAAAG
CTTTAAATATGATTTTAAATTATGACGACGCCATTTTGAC
CAACATTTTTGAACAGACATACTTTGAAAAAGCTGTCGTT
AGCATTTTGCTAACATGACAACACCTTTAGCAGGGTATGT
TTTTAACTTAAGTTAATTTAGAAACGGCAGGAAACCGAGA
CATTAGCTGTTAGTTTGTAAAGTGTTCAAGAAGATTTTAA
GTCGTATGCCATGCGTTTGTGCATTAGCTTAGCTAATCTA
AAGGTTGAGCTACATGAATTAGCAAAATTTATTAGACAGT
TTAGGAAATCTCCAAAGATTATAATGAACCTACAAATATT
TATAATTCTTAAAGCATTGTCTCCAAAGAAATTTGAGATG
AGGCTAGCATTATCAGTCCAGTAGTTGTGAATGTTTGGAG
GATAGTCAGTAGTTAAACAACCTATGTATTTAAAACACTT
CAACGGTACTGTTTCATATAGTTAAACTAAACAAATAGTC
CTTTGATTTCTGTGTATTTTGCTGTTTTGTTGCAATTGAA
TTGACTGCAAAGGTCATCATTATCGTAGACTTGAAAATTG
TACCCTTTTTAACTTTGTGATATTTGCCTTTTCTGTCTAA
ACTAACTCAAGCCATTAAATTGAAACTAACACCCTCAGTA
TTGTACTGTCCACATAAGGGGTCCTAAGCGATATTTTTTT
ACATTTTATTTGTTGTTGTTCTGAGCATGATAACTCCTCT
GTATGTATATGATTGCAACTTTGCTTTCTATCTTTATGTC
AAGAGTATTTATTTAGATAGATATTTTGGTGCTAGTGAAT
GGACAAAAAAAATCTGTACCCTTTTTAAAAATCATGCTTT
TTGTCTGGTTTTGATGTCGCTGTCATATTGCTAATAGAAA
TACTATTGGCTGTGCTTGGGGACATGTTCATATCTTAAGT
ACTGTACTGCTGCATGGACGTACACATTAAGACGACGCAA
ATTGTTAAAACCTTTTCCAAGGCGTTCAGTGTCTTGTGCA
GTGTCACATGGATTTTTTTTTTTACATTTAACAGCAGGTT
CATCACCTTTTAAATGTTTTATTAAATGTGTAATAAATTT
TGAAATTTGTAATAACATGCAATACAAACTCACCCCACTG
AAACACACATATGTCTTATCATATATGCTTGTAGATGCTA
TTCATGAGAAATTACCAAGGAACTTTGCTGCAGTACCATG
GCTTCAGCAGGCACAACATTTTGCAGAACTAGAAAATAGT
CCCTATTCAGGTAACTAGGTGTCACAGATTGGCCAGGCTC
TTCCACCAATTTAACACAATGCCCATCATCACCTGAATTT
TAATCATGCACAGCTGCATCTCATCACCATGAGACTATAA
AAACACACACCTCACACCACTCTTTGTCCGGGCTCGTTCA
TACGAAGCGGACTGATAACGAATACTCTCCACGTATTCAG
TAGCAGTGAGCGATCCTCCAGAAACTTACCTAATCTCTGT
TTTGTCTCCAGTTTGTCCAGTCTGCCCCGTGTTCCAGTTG
GAGGTGTGTGTTTCCTCGTTGTCGTCTCCGTAACTCATCT
GGTGGGTGCTCCATCGTTCTGTCCCATCCCCTACTCATCT
GGTGTGTGTATTCGGTCAGCATCTATATCATCATCCATAC
TGCAAGGAAGACGGATAGTTACATCCCCTTCATCTCAACG
AACGGAACCTTGCATATCCTTATATTGCTCTGCTGTGAAA
ATAAAAGTTTACATTTTCTACTCACCCTGTTTGTCCGTCC
GTTTCCTAACAGAAGCCCGGACCTTTAAAGTTAACAGCAT
GAGCAATCCCGATCCAATTCAGGAGCTGGTAGACGCGATG
AAGAGAGTTTTATCGCCAGCTGCACCACTTCCTGATCCAC
CACCAGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations