ZFIN ID: ZDB-TSCRIPT-131113-2530
Transcript Name: prdm11-202
Previous Name: prdm11-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056351 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056351|OTTDARG00000039256|ZDB-GENE-061221-1 prdm11|OTTDARP00000044189 prdm11-001 LG_ BX088562.12 Danio rerio protein_coding KNOWN, 7715 bp
ACATTTTCATTTGTGGTGTGAACTATCCCTTTAAGGCTGA
CATTATCAACAAAGTTTGAAGAGTAGTGATAACTGACAGA
ACTGCGGAGAGCTTGGAGATGTAAAACTAAAATAGGGGAA
AGGCTGTTCATTTTTAAAACCTTAAACTTCACACACAAAC
CGCCTGCGTAATGTTGCCAATATTTGTTAGGCGCGTTCCC
AAAAATGAACGCGCGCGCGAGACGCTCCCTCACACAACTT
GACACACTACCTAACTTTCCCTTTCCTGAAATTTCGTGCC
CGGTCTGCACAAACGCCGCTTTCTTCCGTTTTCCATGTCA
TTTCCTGTAATAAAAAGATGGTGGTCATAGCAGAGAGAAG
CAGCTGACTGTGGTACAAACATTTGGAGATGATAAACTTT
GCATCGCCCGGGACTAGTGAAATCCCCCCGTGCCGTAGCC
TCGCCGCCGCGGTCCACGGAGCGGCCGAAACCGAGACGCG
CCGCAGCTGAAGAAGACCACCAAAGACCCCGCGACGCACT
GCGTATATCCTATAGACGCATTAATATGTCGGAGTGAAGC
GGAGACTCCATCCTGCCCAGATCATGGCAGATTCTTCCAC
CAATCCAGATCATTCCTCCATGGAAGCTAAAGGCGAATGC
AGCACCAGTGCATCAAATGAGAAGTCAACTGAAGAGCCAA
ACAAAAGGCTAAAAGTAGAACATGAGCGTTATTCCAGTTT
TTGGTTCTGCGAAGAGTGCAAGAAGTATTACCTGGAGGAT
TGTCCTACCCATGGGCCGCCTGTCTTTGTGCCAGACACCC
CTGTGGTATCAGGGGTGCCCAATCGGGCAGCTCTCACCGC
ACCCTCAGGCATCGAAGTGCGAAGAAATGGCGATAAGGTG
GATGTCTACTGCATGGATGAAAAAATACCAAAGGGGGCGC
TGTTTGGTCCTTATAAAGGCCAAATAATGGCCTCAGATAA
ACCTTCAGGGCCGTACTCTTGGATGATTGTTGATAAGGAC
AGCAAATATAAATTCATCGATGGGAGTGACGAAGCTACAG
CTAACTGGATGAGGTTTATCCACATTACTTCTGATGAGAG
TGAACAGAACCTGAGTGCGTTTCAACATGGTGATCAAATC
TACTTTCGAGTGTGTCACAGACTGAAGGTGGGCGAGAAAC
TTGGTGTTTGGTACAGCAGCGAGTACATGAAGCGACTGCA
GAGTGTGTCCCGGGACAGCATTGACCACAATCTGGACACA
GGAGTAAAATCAGAAGACCAGGAGGAGCCTAAAGGCCCAG
TGTTAAGATCCGCAATGCACGGTAGAAGGACCCTAAGCAA
GCATGGAAGCGATGAGGCAGAAAACCAGCCCCAGGCCAAG
AAAAAGAAGATTGACCTCATTTTCAAAGATGTCCTGGAAG
CATCTCTAGAGGCTAATCAAAGTCAGAACAACCCCCTGAA
CAGCACCTTGTCTTTTCCAAGAGCACGAACAAATGTCTGC
CAGGTTTTCTGCCATCCTGACGCAGAGAGTAAAGAGTCCG
TCTTCACCTCTGGGTTGGTTTCAATGGATCACCACGAGAT
TGGCTTTGATGGGAAATGCATTAAAATGGAAAACACGGAA
GAGGATGAGGCCTTGACCAGTGAAGGACCATCCACATCTT
TCTGCCCAAACTGTGTGAGGCTAAAACGTCGAATCCGTGA
GCTGGAGGCCGAACTGCACCGTCTCAGAGGACAGGGGCAT
GCGGAGGTTAAGCCTGTACCAGCTTCTGAGATGCTTGCTG
GTGAGGACCACAGAGACACCATGACGCCCATCCCAGCAGC
CCTTGAAGAGGATGACCAGGATGTTGATTCTGCCGATGAA
TCTATTTCTGCCGACCTCCTGGTGGCTGCAGATGAGTCTT
CAAAACTCTCAGTGGGTTCGGGTCGTCGGATTCGCAGATT
CAAACAGGAGTGGCTGAAGAAGTTCTGGTTTCTCCGTTAT
TCACCTACACTGAATGAGATGTGGTGCCACGTGTGCCGCC
AATACACCGTCCAGTCCTCCCGCACCTCTGCGTTTATCAT
CGGCTCCAAGCAATTTAAAATCCACACCATTAAACTGCAC
AGCCAGAGCAATCTGCACAAGAAGTGCCTTCAGCTTTACA
AACTTCGAATGCACCCGGAGAAGACAGAGGAGATGTGTCG
TAACATGATGACTCTTCTGAATGCTGCCTATCATCTGGCT
CTTGAAGGACGGCCGTTTTCTGATCTGCGCCCCTTAGCGG
AGCTCCTCAAGAAGTGCGACCTCAAAGTGGTGGATCAATA
CATGAACGAAAATGACTGTCAGATTCTCATCCAACACATT
TCTCGAGCATTTAAAGAAGATCTGGCTGAGAAGATCCGCC
TTTCACCCTTTCTAAGCATCATCATGGATGGGCAGAATGA
TGATCTCTTGGCTGATATGGTTGCTGTATATGTCCAGTTC
ACCACCACTGATGGGCTTCCTGCCACTGAGTTCCTCTCCT
TACAGAGGCTTTGTGGAGGTAATGTCGAAGGTTACCTTCA
GGCTGTGGATCGTGCCTTTGGAGTCCTTGGGCTAAGACTC
CAGGACATGCTAGTCGTTGGTTTGGGAATAGATGGTTCAA
ACATTTCCTCTAGTTTAAGAGCTAATCTTTACGTAGCCAT
CCGAAAGACAATTCCATGGGTGTTGTGTTTACCTGTGATG
ATCCATCGCCCACATTTAGAGGTTCTGGATGCCATTAGTG
GAAAGGAACTGTCCTGCTTGGAGGATTTGGAGAACAACTT
GAAGCAACTGCTTAGCTTCTATAGATATTCCCCACGTTTG
ATGGCTGAGCTAAGGTCATCAGCACCAACGCTGTCGGAGG
AAACTGAGTTTCTTGGTGATATTCGAGCTGTTCGTTGGAT
CATAGGGGAACCCAATGTTCTCAATGCCCTAATTAAGGAC
TATCTGGAGGTGGTGGCTCATCTGAAGACCATAAGCAACC
AAACACAAAGGGGTGATGCTGCTGCCATTGCTCTGTCTCT
CCTACAGTTCCTTTTGGACTATCAGTCAGTGAAGCTGATT
TATTTTCTCCTGGATGTCATTGCTGTCTTTTCACGGCTTG
CTTTCATCTTTCAGGGTGACTATCTGCTGGTGTCACAAGT
GGACGCAAAAATTGAAGATGCCATTCATGAGATTGGTCAA
CTGGTGGACTCCCCAGGGGAGTACCTACAAGAATTTGAGG
ACAACTTTCGGGAGAGTTTTAATGGTGTGGACCTCAAGAA
CTTGAGGGTTGCCGAGTCCAAGTTTCAGTCAATTCGAGAG
AAAATCTGCCAGCAAAGTCAATGCATTCTGGCTCAGCGCT
TTGAACCACGCAGCCGCACAGTTGTCCAGGCCTGTCAGGT
CCTTGACCTAGCCTCGTGGCCTATTAACAGGGATGATCTC
GGTGCATATGGAGAGGAAGAGATCCTTGTCATTTTTGACC
ACCTGGAGACTATTCCTTCATCCGGCCGTGAACGCTCAAT
CGAAAGAACAGATGCCAGAGGAAGTCTCGTGGTTGAATGG
AGGGATCTGAAAGCTGATTATTGTAGTGTGAATGGTTTTA
AAGAAGTCGTCAGCCACATCTTCAGATACAAGCAACGTTA
TCCTCTTCTCAATCACATTCTGCAGATTGTCAGAGTCTTG
CCAACATCTACGACATGCTGTGACAAAGGAAGAGGCTCGT
TGCAGAAAGTGCGCAGAAATAGCCGTTCCAGACTGACTCT
GGATCAGATCAACGATTTGCTCACCTTGGCTGTCAATGGA
CCGCCTATTGGGAGCTTTGATGGAAAGCGGGCATTGGACA
GCTGGTTTGAAGAGAAATCTGGGAACAGCATTTCACTGTC
GACAGAAGTGCTGAGCAGAATGTCCACCACCGAACAAAAA
TCTGTGTTGCACAATATGGATATGAATGCAGAGTATTATC
CTGATGTTTGATTGATCGGAGCCAATTTCTCAGCCAATAT
GATTCCAAAAAGCCATCTCATTGGAAAAGGGCTGATCGGG
ACTGTAATGTGATTGGCCAAGTAGTTTGACACTGGCCCTG
CTGCTAAATGGCCTAGATCAGCATCTTCTCTAAGAGTCGG
TATGAATGCCTTTGCAGGTCGCAGGCACATGAAACACTTT
AAAATGTTCATGTAAATGGTTGTAATGTGTATTTTTGTTC
CAAAGAGATGCTGTTTTCTAGTTATGAGGATCGTGGCTGT
TAGGTGAATGTTCGATTGAACACCATTTCTTCAGGCATTG
GTGAGTGAACCCAACTTTTTTAGTCTCTGAAAATGCCACC
TTCTGATTAAGAGACAAACTTTCTAAAAAAAAAAAAAAAA
AAAAAGAAACGTTTTCAGTATTTGATCTGCAATATAATTT
GAGCAATCAGAAGCATTTGTATGTAGACTTTTGTGTATGG
AAAATAACAAAAGGTGTTAAATTTTCATAGCATGTTCTTT
ACGTTTTTTTATCCCTAACTGCAACGGAAGCCACTATTTT
GCCATGCAGTATATACCATTTTTTTCTATCTTCAATCTTT
AAGTACTCTTGGTTTGTCAATGTGCCATAATAGTTAATGC
AATGAGGCACCCGTAATGTGATGTTTACACCCAAGCTGAT
CGAAAGATAAGTATAGTATGAACCAACATGAGCCAGTTCA
AATAATTTTATAGTGAAATATGAAACTGATTCTGCATCAA
ACCAACAAATATATCATATGTTTACTTATTCACGCATCAT
CAGAATAAATATTCAAATGTTTACTGAAAATAGAAAGCCG
TAAACAAGCTCAAATCCGATTGTTAAGTGTGACGTCACGC
GAAGCAGCTTCCGGGTCCAAGCGCTCTGTTCAACTGAATG
GGGAGACTCATGAAATGGTAATAATAAACGTTTACAAAGC
GATTTAATACCTTCGAAAATCACGATCACAGTATATATGT
CCATGCCTAATATCCGATGTCAGAAAGTGATTCATTTTCT
TTTTTAATTGTTAAATTTTTGGCATTTGTTATGCAGCAAG
CCCAGAGATTGTTGTGTACACTATGACTTTATATAAAATT
TAACTTTAATGTGTGATAGGAATAAAACGTGATCATAAAC
GAATGATTTCTCCACTCAAATGAATGGCGACTTGGACCCG
GAAACAGTATTACATACGTCATCACTTAACAAGCGGATAG
CATTACTATCAGTCTCCATCAGCAATACTTTTCATTTGAT
ACAAAAGATTGTGCATGAAGTCACCACTAGTAGGCGACAC
TGTACAACACTTTACTTTTGGAGGAAACTTTGAAGACATT
TAAGCACCTGAACAAAAAAAATAGCTGTTTGGAATCAAAG
ATGTATAAGAACAAAGCTTTTGTATTTTTGATTGTATGAA
TTTGTGTATTCAGTGCATGCTCAGCAACATTTATTTTATT
CAAAGATGTTATGTTCAGTTGTTATCCTTGCCTTGCCACT
AAGTTCCATAGATTTCTTTCCCTGTGCAATATATATTTTA
CTTAAATTGTGTATTCTTAAATATAAGCAAATTTAGTACT
TACTAATAACAATGTTCCTTAAATCCAAGCTCTGGAATTT
AAAGGTGATTGAGCATGTTTTACAAGATTCACTCACTATT
GTTTCTTCACCTTGCTGTACAAATTTCCATTTTTTTTTAT
TCATTACTTTTTAAAAATTACTTTATAAGGTAAAAATTGT
TGTGATCTGTTATTAAAAACATGACTTTGTAACAGTCACA
TTTTTAAAGTTGAAATATAACAATTTTAGTAATAAAACTG
GTTAAAACATCATCTTTTAGAAATACAGTAAACACTGTTC
ATTTACGAGTCTCAAACAAATACATGCAGTAATATTGAAC
AGTACACTACCTGACAAAAGTCGCCGTCATCGATCCCAGT
TGTAAGAGCAATAAATAATAACTTGACTTCTAGTTGATCA
TTTGGAAAAGTGGCAGAAGGTAGATTTTTATCAGATGATG
AATAATCTGTTGAACTGCATCCAAATCATCACAAATACTA
CAGAAAACCTATTGGAACCCGCATGGACCCAAGATTCTCA
CAGAAATCAATCAAGTTTGGTAAAGGAAAATCATGTTTTG
GGGTTACCTTCTGTATGAGGCGTGCAAGAGATCTACAGAG
TGGATTACAACATCAACAGCCTGTGGTATCGAGGCATTTG
TGCTGCCCATTACATTACAAACGTCAAATTCTTCTGTAGG
ATAGCGCTCCTTGTCATACTTTAGCCTCCACATCAAAGTT
CCTGAAAGCAAAGGAGATCAAGGTGATCCAGGATTGGCTA
GCCCAGTCACCAGAAATGAACATTATTGAGCATTTCTATG
GAAAGATGAAAGAGTCATTGAAAATGAATCCAAAGAATCT
TGATGAACTCTGGGAGTCCTGCAAGAACGCTTTCTTTGCC
ATTCCAGATGATTTTCTTATTAAGTGATTTGAGTCATTGC
TGAGATGGATGCAGTCCACCAAGCTCATGGGAGTCATGCA
CAATATTAATTATTTTTCCACTGCAGCATGACTTTATATT
CTGTACTGTACATTATTTAGCAAAACTTTGAGCAAAGTCA
GACCCTAATTAAATAATTAAAAATCAAGGCATGATCATAC
TTTATTTTGGTAAAATAAGTGTAATCTAGACGCATTTGCC
TTTCATATAAGCCTCTTCTGATACCAAATGATCAATTTGA
AGTCAAGTTATTATTTGTTGTTCCTAAAACTTAGATAGGC
GACAAGACTTTTGTCAGGTAGTGTATTGACTGAAATCAAG
CAGTTGAATGCCATCTTTAAGTTACATTAACCTTTTCATT
TTCTAGAGTCATTGCACGTCCGAACATTTAGCATGTTTAA
AGACTCAAGCTTGTTTTTTATGGAAATTGTTTCAGTGAAT
CCATTTTTATTGTTTAAATGAATGTACATTTCAAAAGCAG
TAATTTAGTCGAAAGATCATTATCATTTAATATGTTAAAC
TGTTGTTTCCATGTAAGTTTTGTTAGCCTTTCTTGTCTTG
ATAAGCAGTTGTTGCCATAACATATATAGCAATAGGATTA
TGTTAAGGGTTGATAATAAGTGAGCTGCCAAAAAATCTGA
TTTTTTTGTTTGTATGTGAATGCTTTTAAATGTTAGACTG
TTACCTCACAGTGAGGTATGCCATATCTTCTCATATTGTG
TTGGGAGTTAAATGCCGTAGTTGTGTCAAAGCAAACATTT
GCTCATCTTCAATGATGATTTCTCAAAAAATGAGCCAAAT
TCAGCTTGATTTAGTTTCATAAAGGCTTTACTATATATAT
ATATATATATATGTTTTATCCCTTTTGTCAATGCTATGTG
TACCAAATGTAAATATCTAGATTGATGATTTTGTATTTTC
CTGATTTCCATGTCATGTAATCACAATAATGTGCAAGGTC
CTTATTGTTTTTCCAACAATTACTGATGATCTGTTTTGAA
CTGGGAGATTCTAGGTTGAAAAGTTAAAGAACAACATCTG
TTTTTAAGTTTATGTTGAAATGTTAGCTCTATTTTCTCAT
ATATATTCATTATAAATCATACACACACTCTTTACTTTCT
GAAAACATAACACTGGAAACTCGAAAAATCTGAACTACAT
GTGAAATGTAAGCCTGGAGAATGTGTACATGTATTATAGA
ATCACACTTTAAATTTCAGCATATGGACTCTATATTCAAC
AATTATTGGTTTAATAAAATGTTTTGTTTTGTTAT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
prdm11-202 Contained in:
[BAC] CH211-286C4 (1)

Genome Resources: Vega_Trans:OTTDART00000056351 (1),  Ensembl_Trans:ENSDART00000157076 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DN891480 (1) 778 nt
GenBank:DT865728 (1) 754 nt
GenBank:CT623336 (1) 722 nt
GenBank:EH465853 (1) 689 nt
GenBank:EB946706 (1) 603 nt
GenBank:DQ851832 (1) 472 nt
GenBank:CT623337 (1) 449 nt
GenBank:EB776339 (1) 421 nt
GenBank:DN901697 (1) 319 nt
CITATIONS (2)