Transcript

ca16b-203

ID
ZDB-TSCRIPT-131113-2183
Name
ca16b-203
Previous Names
  • ca16b-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054997 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054997|OTTDARG00000038386|ZDB-GENE-080818-1 ca16b|OTTDARP00000043139 ca16b-003 LG_none BX663614.24,CT485610.7,CU019675.6,BX005101.8 Danio rerio protein_coding KNOWN, 632 bp
AGAGATCATGAGCTTTTCAGAGCCTCCGCTTCTCTTTTTA
TCTCACCTCTTGAGGATGACTAGCATCTGCTCGCTGCTCT
GCTTAAAGTACAGGAGATTCTTCCAGACGGCACATTTCTA
TATTGAAGACAGAAACTCCCCCAGAGTGATCCACAATGAC
AGCTTCCCCATCATCTCTACAGCCGATGACCTGGAGGCCA
TGCCAGTCCGGCAGTTCATCAAACACATCATGGAGCTTCA
CTCCAACAACCGGCATGGCTTTTCTCAGGAGTTCGATGAG
GTCCAACACTGCACATCAGAAATGAAGATTACAGCAGAAC
ACTCCAATCACCCAGAAAACAAGCACAAAAACAGATACAT
CAACATCGTAGCCTATGATCACAGCAGAGTGAAGTTACAG
CAACTGCCTGGGAAAGACTCCAAGCACAGTGACTACATCA
ATGCCAACTATGTGGACGGGTATAAAAGAGCCAGGGCTTA
CATCGCAGCTCAAGGCCCTCTCAAGTCCACGTTTGAGGAT
TTTTGGAGAATGATCTGGGAACAAAACACCACTGTGATTG
TCATGATCACAAATTTAGTGGAGAAAGGCAGGAGGAAATG
TGATCAGTACTGGCCGTCGGAGAACAGCGAGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations