Transcript

ca16b-002

ID
ZDB-TSCRIPT-131113-2182
Name
ca16b-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054994 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054994|OTTDARG00000038386|ZDB-GENE-080818-1 ca16b|no_translation ca16b-002 LG_none BX663614.24,CT485610.7,CU019675.6,BX005101.8 Danio rerio protein_coding KNOWN, 1123 bp
TGTGCTTCAGTTGTCCAGTAGCCAATCCTCGGCTGTCTTC
AGCGGGCGCTCAGAAGCTCAGCCTTCGGCGCTAGGATCCA
GAGGGCAGGGCTTTGATTTCTCAACTAATTCCTCTGGCAA
AACACGAAAGGCTCATATGCACAACTTCCTGGATAGAGAA
GCGGATTCAAGCGACTGACTTTGTAGATGCGCGCGCTCGA
GATAGAGAGAGAGAGAGCCGCTGTACAGAACAGACGAGGA
CGAGCATCTGAAAGTGCGTCCGGCTGGGATTAATAACTAC
TTGATAATGTAAAGAGAATGTAAAAAAGGACGCCACAGAC
AAGAGAAGTGTGCGCGGATTGTGGGCTGTCCGAAATGTCC
CACCAAACAGGCGCAAGATTCGTCGCCGGTCATTAAACAT
CGCCTCGACCACTTGTCATTATTTTGGTTCGTCAAGTTTG
TGGTGTTTTTTCTTCACTGACGCTCAATTTTGATCCGCCA
TTCTGGCTCTAATTGCGCATTTAGACATGTGGAGATTGCG
AGGACCGTGTCGTTTAGGGATGTTGTGTTTGACTTTATCA
GCCCTTCTCATCCAACCCATCAGCTGTCATCCCGCTTCAC
ATGTGGAAACCGTGCGCCGAGGGAGCTCAGCCAATCAGAG
AGAGCGGAGGGCGTCCGGGGAACCCTATTGGGCGTATTCA
GGTGAGTCATCGACCAATAAACAGCGAAAATGTGTACACA
GCATCAGTAACAATAGCAACAATGTTTACTCAGCATAAGC
CTGCATGTGCGTCTGTGGGGAATCAACCCTATTGGGAAAT
TTAATGAGCATATTTCCTTTTGTGAAGCGGCAGGTGGGTT
TTGTCTATTAGTTTTACATGTAGCGGAAAAAAAAACACTG
CTTTGGAGCCGCTGGGCAAGATCAATGAATATTCTGATTG
CTTTGTCTTAAAGTGGGAATTTTTGCATAATCTATAACTC
ATCTAACTCAGCAGAATTTGTGAGCAATTGGTGGATTTTT
CTTATTTGGCTCTCATTGAGAGTTATGAAAATGAATCAAT
CAATGGCCTCTGGCGGACACACAGTCAATAATGGTGAAAA
GCAGCAGCTCTTATCTCATTTCAGACTCCGTTTCTGATTT
CCC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations