Transcript

kcnb1-201

ID
ZDB-TSCRIPT-131113-2180
Name
kcnb1-201
Previous Names
  • kcnb1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054988 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054988|OTTDARG00000038381|ZDB-GENE-090831-3 kcnb1|OTTDARP00000043133 kcnb1-001 LG_ BX546446.15 Danio rerio protein_coding NOVEL, 2889 bp
GCTGCAGCGACGCCTGAACCGAGGCTGCTTCAGACCTGCT
CCAAGGAGCTGATGCCGTCCTCCCTAACGCATATCAAATA
AAGCAGGGATATAGTTTTCAGCATTGCCCTCTCTTCAGGC
GCCATTTTCACACAGGTTACTCGTAACGACACAGAAGGAG
CTGCTCCAAGAGCCTCTCGGTGCGGGTGGCAAAAGGGTTA
AACGCGCCGTCTCTCTGCCATTGGGCGGCGAGACTATGGA
GATCCTGCCATCTGCAAGGAAAGCAGCTGTCGACTTCACG
CAAGACACGTTAGATAGCAGTGAATGAAAACAGCGTGGAT
TCGCCCCAAGACTTGTTGATCTTTTTTTTCCACGAGAAAC
GAGCGGAGCGGTATGTGTTTGTGTGGAGGAGACGCACGAG
CTGCTGTGCGCCGGCTGTGTTTGAACTGTGACGTCCTTGC
GCTTTCTTCCATTTAAACGCTTTATTTCACGCCGCTGTCA
GCAATGAGTCTCCACAAATTAAGCTCAAACAGAATGAAAC
AGCTCGGAAAACCACTATCCACACCGCCTGTCCCACGGCC
AAACTCATAGTGTAGCCCTACACAAACACACAAGATGGAG
AAACCCTCGGCAGGAATGAGTAAAGTTGGCTCTCGCTCGA
CAGCCTCTCTGCCCCCGGAGCCTGTGGATATAATCCGGAG
TATGTCCTGCTACCGGCGTGTCAAACTGAACGTAGGTGGT
CTGCCGCATGAGGTCCTGTGGAGAACCCTGGACCGACTGC
CGCGCACGCGACTGGGCAAGCTGCGAGACTGCAAAACCCA
CGAATCCCTCATGGAAGTATGTGACGACTACAACCTGGAG
GACAACGAGTACTTTTTTGACCGGCATCCCGGGGCCTTCA
CTTCCATACTGAACTTCTACCGCACTGGGAAGCTGCACAT
GATGGAGGAGATGTGCGCCCTGTCCTTCAGCCAGGAGCTG
GACTACTGGGGAGTGGATGAGATCTACTTGGAGTCGTGCT
GCCAGGCCAGATACCATCAAAAGAAGGAGCAGATGAACGA
GGAGCTCAAGCGAGAAGCTGATACGCTGAAGGACCGAGAG
GGTGAAGAATTCGATAATACGTGTTGTTCGGAGAAAAGGA
AGAAATTATGGGATCTACTGGAGAAACCGGGATCGTCTGT
AGCAGCCAAGATCTTGGCCATCATATCAATCCTATTCATC
GTGCTCTCCACTATCGCTTTGTCTCTCAACACTCTCCCGG
AACTTCAAGAAACAGACGAATTTGGTCAAACTACTGATAA
TACCCAGCTGGCTCACGTGGAGGCAGTGTGCATTGCTTGG
TTCACCATGGAATATCTTCTTCGCTTCCTTTCCTCACCAA
ACAAATGGAAATTCTTTAAAGGTCCTCTTAATGTCATCGA
CCTGCTTGCCATCCTACCATATTATGTCACCATATTCTTG
ACAGAGTCCAACAAAAGTGTACTGCAATTCCAGAATGTAA
GACGGGTGGTGCAAATCTTTCGTATCATGCGAATTTTGCG
CATCCTTAAGTTGGCTCGTCACTCCACTGGGTTGCAATCA
CTGGGCTTCACGCTGCGTCGGAGTTACAATGAGCTAGGCC
TGCTTATCCTCTTCTTAGCAATGGGGATCATGATCTTTTC
CAGTCTAGTTTTCTTCGCGGAGAAGGATGAGGATGACACC
AAGTTCAAGAGTATCCCTGCCTCCTTCTGGTGGGCCACTA
TTACCATGACAACTGTTGGATATGGAGACATTTACCCTAA
GACGCTTCTGGGCAAGATCGTTGGTGGTCTCTGCTGCATA
GCTGGAGTTTTAGTCATTGCCCTACCCATTCCTATTATCG
TCAACAACTTCTCTGAATTCTACAAGGAACAGAAACGACA
AGAGAAGGCCATCAAGAGACGTGAGGCTCTAGAGCGGGCT
AAACGCAATGGCAGTATAGTTTCCATGAATGTTAGAGAGG
CCTTTTCCCGAGGTACAGATCTTCTGGATGTTGTAGTCAT
GGATAAGGGTGAGAGATCTCAGGACAACCATCTCTCACCC
AGTCGATGGAAATGGTCATCAAAGCGGGGAACTTCAGAGA
CCAGTTCTAATCGTTCCTTTAACCCAGACCAAGGTTCCCC
AAGCAAGGCAAGAGCTTCTAGTCCACAGAGACTCAATGCA
CAGAAACTAGAAGACATGTACAACCAGATGGCAAAGACTC
AGTCACAGCCCAACCTAAACACCAAAGACAGAAATTCATC
CCGAGCAGGCCATAGAAGGGATGAAATTGAGCTGGGAGCC
TTGCCAGGTCAAGGAGGCGACCCAATGAATGGGGGCCGTG
AAGGGGTGGTAGACATGAAAAGTCTGTCGAGCATTGACAG
TTATATCAGCTGTGCAACAGACTTTCAGGAGAACCCACGA
TTCCACTACAGTCCGGCAGGGGGTCTGTCGCTCCCAGAGA
GCTCTCGGTTTTCCCACAGCCCCGGTTCTGGCCTATCTAG
TCGAGTCAGTGCAAATCCAAGTCTGCAGACTACCTTAGAA
CACGAGACCATGCTCACTCCCCCTTTTTCTGGTGCTAAAC
CTCTCAACACTGATGGTTCACGGCAGCAAGGTCTGCTTGG
AAACTCTCAGAAAATGCATTCAGTTAGGGTGAATCCTCGC
AATTGTGCAGAGAGCAGTCCTTCAGGTGGCCCTCTGTCTG
ACAGCTCTATTCTTTCCGACCACTCCATCTTAAGCCCAGA
AGTGTCAGTCTACACAACAGCCAGTACCAGGACTCCACCT
AAGACACCTGAGAGGAAGGTACTCACTCCTACAGTCTTTA
CTTTTCATGACGCATCTATCAGCAAGTACATTGATGCCGA
CACAGATGATGAGGAGCACTTGCGCGAAAGCGGCCCATCA
GATCGCCTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations