ZFIN ID: ZDB-TSCRIPT-131113-2171
Transcript Name: npepl1-201
Previous Names: npepl-001, npepl1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054960 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054960|OTTDARG00000038358|ZDB-GENE-050417-177 npepl1|OTTDARP00000043110 npepl-001 LG_none CU467627.6,CU467883.3 Danio rerio protein_coding KNOWN, 2193 bp
GGGCTGTATATCACATACCCTAACTAAACTGCAAGCACTC
GCGAGACGGAGCAGCAGAAGCGGAAGGTCAAAGTGCGTCT
TCCTCCAGAAGAGTCTCATTCGGGCGGAAGATGGCGAACG
TGCTGCTGGAGTTCAAGGCTTCAGCCGGGGACTCGGAGCC
GCAAAACCGGCCGGTCCTGATCGTCGGTCAGCTCGCTAAT
CTGCAGCAGGCCAACTGGACCCAGGTGAAGGGAAAACTAC
AGCCAGTGGTCACCAAAGAGCTCTGGCAAGCCGCTCTGTC
TTCTCTGAACCCCAACCCTACGGACAGTTGCCCGCTGTAT
CTAAGTCATGCAGCGGTGGCGGCTCTTCCTTCACGGGTCA
GTCGCCACAACAGTCCATCCTCTGCCCACTTCCTCACCCG
CCTGATCCGAACCTGCCTGCCTGCCGGCAACAACCGCTGC
ATTGTGATGGTTTGCGAGCGCACTGAGGTGTTTGCATCAG
CGTGTGCTATTGCTAGAGCTTTCCCGCTCTTCACCCGCCG
CTCGGCGTCTTCTCGCAGGACAGAGAAGAAACACGTGACT
CTGGAGTTTATCACTGTGGGTCAGGACAACGGGCCTCTGG
AGCTTTCCACACTTGAGTGTCTTGCTAATGCAGCGGATGG
AGTTCGTCTGGCTGCTCGAATCGTGGACACTCCATGCAGC
GAGATGAACACTGATGACTTCCTGGAGGAAATCAAGACAG
TGGGAAATGCCTTGGGTATCACTCCGACTATAATTCGAGG
AGAGGAACTGAAACAAAAGGGCTTTGGAGGCATCTATGGA
GTTGGTAAAGCGGCCCTGAATCCTCCTGCTTTGGCTGTGC
TCAGCCACACACCTTCAGGTGCCACACAGACCATTGCCTG
GGTGGGCAAAGGCATTGTCTATGACACCGGTGGACTCAGC
ATCAAGGGCAAAACCACAATGCCGGGGATGAAGAGAGACT
GTGGAGGAGCTGCTGCCATTTTAGGAGCGTTTAAAGCTAC
TATTAAGCAGGGCTTTAAGGACAATCTTCATGCGGTTTTC
TGCCTGGCTGAGAACTCAGTGGGACCTGCAGCCACTCGCC
CAGATGACATTCACACTCTCTACTCTGGAAAGACTGTAGA
GATCAACAACACTGATGCTGAAGGCAGGCTGGTGCTCTCT
GATGGGGTTGTGTATGCAAGCAAAGACCTGTCAGCGGACA
TCATACTGGACATGGCAACACTGACCGGCGCTCAGGGAAT
CTCCACAGGGAAGCATCATGCAGCAGTGATGACCAACAGT
GAGCAGTGGGAATTAGCGTGTGTGCGCGCCGGACGCAGCA
GTGGAGATCTGGCTCATCCTCTGGTTTACTGCCCAGAGCT
GCACTTCAGTGAATTCACCTCCGCTCTTGCAGACATGAAG
AACTCTGTGGCGGACCGTGAGAATGCTCAGAGCTCCTGCG
CTGGCCTCTTCATCGCCTCTCACCTGGGCTTTGATTGGCC
GGGTGTTTGGGTGCATGTGGACATCGCTTCACCTGTCCAC
GCTGGTGAGCGAGCCACAGGTTTCGGTGTTGCTCTGCTCT
TGTCTCTGTTCGGACAGGCGTCTGAAGACCCCCTGCTCAA
CTCTGTGTCTCCATTGGGTGCCGCAACGGTCAAAAATGCA
TCTGAAGATCAGATGGAGAGAGACTGCAAGAGGAGGAGAC
TGGTCTGAGATCAGTACAGACTGTTCTTAACCACTAAAAA
AAAAAAGTTTAATATTAATCACGCCTTGTACAAACGTTGC
ATCCATTAGACTCGTACACTCCTTCCTCTGCTCCATCGGA
AGTACAAAGTAATAAGCAGCCCTGTATACACGGTTATGAA
TGAAATAAAAGTTGAAGATCGTCTTGATGTTTTGTAATGT
TCTCGTTCACAGTTTGTAGTTGCCATAAGAAATGTTTCAG
GGATGAGAGGAGGCACGTGAAATATCTCTCTGCAAATACT
GTTGTTGGTTTTTTCTGATCAGAATATGTTTAATGCAATC
ATTTGATTTTCATTCCAGACATGAATGATGACATGATCAC
GGTGTCTTTGTTTGGTAATTGTTTTTTTTTTTTGGCGCTA
AATGAGTGCTGCCAGCAAAATCCACTTAATGCCAATTTTG
TTAGTGTGGCAGGTGAAGAATATGGATTGTGAATGATGAA
ATCTTTTCCGAGTAAATGTTTGAATGAATGATT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
npepl1-201 Contained in:
[BAC] DKEY-249D8 (1) (order this)
[Fosmid] CH1073-298I18 (1)

Genome Resources: Vega_Trans:OTTDART00000054960 (1),  Ensembl_Trans:ENSDART00000024578 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC155148 (1) 2105 nt
GenBank:EE684971 (1) 984 nt
GenBank:CT669588 (1) 863 nt
GenBank:EH470092 (1) 788 nt
GenBank:CV486941 (1) 757 nt
GenBank:DN597130 (1) 721 nt
GenBank:CT669589 (1) 627 nt
GenBank:CD589836 (1) 439 nt
CITATIONS (2)