Transcript

mst1-201

ID
ZDB-TSCRIPT-131113-2163
Name
mst1-201
Previous Names
  • mst1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054920 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054920|OTTDARG00000038328|ZDB-GENE-020806-3 mst1|OTTDARP00000043081 mst1-001 LG_none CR854824.7,CU207276.13 Danio rerio protein_coding KNOWN, 2430 bp
CAAAGTCCTCATTTGAGCTGTGTGGCTGCAGTAAAGCGTC
TCTCACACCATGTTTATGCTCTTCTTTCTCACAGCTCTCC
TGCTTCGACTCGATTCAGTTGATGGATACCGCAGCGCACT
AAATGATTTTCAGCGGTCGGAGGGAAGAGAACTGGTTCTG
AAATCCTGGAACGTGAACCGACTAACTGAACTTCCGGGAG
TCACACTGGAGGATTGCGCTAAACGCTGCACAGAGAGTCC
AGAATGCAGAGCTTTCAACTATGAGTTTCGTCCATCATTG
GTGTGTAAACATCTGCCCTGGGTGGGCGACGGAGACAATG
CAGACGTGAAGAGAAACGTGAACTGTGACCTCTATGAGAT
GAAGGTATATGTAAGGAAATGCATTGTGGGTAAAGGAGAA
GACTATCGAGGGAAAGTGTCGACAACTACAAGTGGACGAA
CATGTCAACAGTGGTGGTCAAAATTCCCTCATGACCACAG
ATGGACTCCGTCTGCGACTAATGGCCTGGAACTGAACTAC
TGCCGAAATCCAGACGGCGACCGCATCGGCCCCTGGTGTT
ACACCACTGACCCCGAACGCAGATACGAGAGCTGCAATAT
CCCTCAGTGCAAAGACGAGGTGTGCATCACTTGTAATGGT
GAAGACTACAGAGGGCAAGTGGATCACACTGTCAGCGGAA
AAGAGTGTCAGAGATGGGACCAACAGTTTCCACATCAACA
CATCTACCAGCCGGAGAAATATCCGGATAAAAGTTTGGAT
GATAATTATTGTCGCAACCCGGATGCGTCTCCGGTGCCCT
GGTGTTACACCACTGACCCAACAATGGAGAGAGAGAGCTG
TGATATAAGCAAGTGCCCTGAATTTCCCAAGCGTCGTCTT
CGCTCCAGCTACACCACTAACTGCTTTCGGGGGCGAGGCG
AGGATTACAGGGGCAAAGTCAACGAAACAACCTCTGGAAT
CCCTTGTCAGCGTTGGGATGCCCAGAAACCTCACGAACAC
CCATTTTTCCCTAAAACCTACGAGTGCAAGGGTTTAGAGG
AGAACTACTGTCGTAACCCGGACGGCTCTGAAGCACCGTG
GTGTTTTACGTCTCTGCCGGAGATGCGGACGGCGCTCTGC
CTGCAGATCAAACGCTGCGCTGATGACATCGAGGCTGAAG
ATTGCTATAATGAAATCGGCAAAAACTATCGAGGTGTGGT
CCGCAAGACCCGGAAAGGAATCCTCTGCCAGAAATGGAGC
ATCAACACACCTCACAAAACCAAGATAAACCCCAAAACAC
ACCCAGAAGCAAACCTTACGGACAACTACTGCAGGAATCC
AGACGGAGATCATCACGGCCCCTGGTGCTACACCTCTGAC
CCCAAGACTGAGTTTGACTACTGCGCCATCAAGCAGTGCG
CTGGAGAGAAAGTGCCAATCATCGGTCCAACAACCGAGGT
TGAGTTTAATGAGTGCGGAAAGCGTGAAGACCGGCTGAGG
TCCAGGTTAAGAATCGTGGGCGGCACACCTGGAAACTCCC
CCTGGACCGTCAGCCTCAGAGATCGGAAAGGGAATCACTT
CTGTGGAGGCTCTCTGGTCAGTTCTGAATGGGTCATCAGC
ACTAAACAGTGCTTCTCATCCTGTTATGTGGACCTGACGG
GATACACCGCTATGATGGGCACCTTGTTTCGTGACCCAAA
AGAGGGAGAACCAGACCTACAGAGGATTTCTCTCACCAAA
ATCGTCTGCGGCCCTTCTGAATCCCACCTGGTCATGCTGC
AGCTGGAGACTCCTGCTCAGTTTAATGAGCGCGTGTCCCA
GATCTGCCTTCCTCCCGAGCGCTACATCGTTCCTGATGGG
ACCATCTGTGAAATTGCTGGATGGGGAGAAACTAAAGGAA
AGGGAGATGAAACGGTGCTGAATGTGGCTCAGATGCCGGT
GCTCAGCAATAAGGACTGTAACCAGTACTTCAAGGGCCGC
GTGCGTGAGAATGAGATGTGCACCATGGCATTCCAGGCTG
GAGTGGGAGCCTGTGAGAGGGATTACGGAGGCCCGCTGGC
CTGTCAGAACAGTGACTGCTGGGTCCTAGAGGGAGTCATT
ATTCCCATGCGCCGCTGTGGACACGCAGGACAACCCAACA
TCTTTATCCGCGTCTCGGTTTATGTGGACTGGATAAAGAA
AGTCATGGAGATGACCTAACTAACAGAGAAATTCATCTGC
TCATATATAAAGTAGACAGAATGTAATATACTTAAAACTT
AATATACCTTTTTTATGAATATGCAAGCATTTTGTATCAT
TTAGGAGATTAATTGACTTAATATTCAAGTTTGCAGTTGT
GAAACATATAAATATACATGTGCACATATATGTACACTTA
AACTAACACCACAGGTCTGAGTTTTCTTGAATTTTGTAAT
ATTTCTAATGTTAATAAAGTGTTAAAATGG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations