Transcript

kank4-201

ID
ZDB-TSCRIPT-131113-2124
Name
kank4-201
Previous Names
  • kank4-001
  • ch211-90h23.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054708 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054708|OTTDARG00000038180|ZDB-GENE-120423-1 kank4|OTTDARP00000042946 CH211-90H23.1-001 LG_ CU570976.5 Danio rerio protein_coding PUTATIVE, 5391 bp
CATATATTTGGCCAAAATGATTGACTATTTATTTTTATTT
GTTTATTTATTTTGTTGTATTGCTAAACAGAACAATTTAA
ATACAATGCATACATAATTATGTAATAAAAAGAACTTCAA
GTAAAACATACATTCTACTTATATGAGTGTAGCTGATTAA
ATGCACCTCTTCTCATTCCCTACAGTGTACACCACGCAGT
CTAACAGAATGCAGGCACACCAGCCCTGGGAAGAAGCCTG
GAGTCTGGAAATGCGAAGAAATAGAGCAGCGAGCTCAAGA
ATGAGAGGCATGTCCTGTACTCTTTCAGCCCCAGCTGAGC
TGTGCTGTTTTTTAAATCACTTTACCACACTAAACCCTCC
TCAGTATCAGTGACACACACACTACACTCCAGCTGGACAC
ACATACACATGTCAGTGCAAAGCTCAAGCAGCATACATAT
TGTATAGGCAATGTGGATAAACAACAGCATAATCTTTTAG
CATGCACTACTTTAATCCTATAGCATCTGAACATGATGGG
GATCTGTATGGGGGTGTTGGCTGCTGCTGCTGATGTGTGT
GTGTTAGTGTGCCTGACCCTGCGTCTGCCATTGGATGAGC
TCTGTGGAGGGAGGTGTGTTCAGCCTCACAGTATAGCGCT
TGTTATGAGAGCCTTCTGCCGTCCCCTTCCACAAACCTCA
ATAACAATATCGCAGAGGCTGAGTGAGTGTGAGTGTGTGT
GTTGAGGAGTGTGTAGCACCATTGCTGCTGCTGCTGCTGC
CTGCGGCTTCCTCCCTGTGCTGGATATTCCTTGAAGGTCT
GCCTCACCTCTGCAGTGCCTGGGAAAAAATAGAGGGACCC
TAAGAGACTGAGGTTGAAGTTCAAAGAAAGGAAGGGAGGG
GTGTTGCATGTTTTTGGTAGACGGGGAGGGGAGCAGGATT
CACAGCACATGCTAGGTTTCTAGTGTTTACATCAGATCCC
ACTCATGAGACTGCAAAAACAGAAATAATGGACAAGAAAA
GTGCAAATGGCTTTGCTACTAAAGCCTCTGAGAGTGGAGT
ACAGCGAAAACAGCTGCCATATTCTGTAGAGACCCCCTAT
GGGTTTCACTTGGATCTGGACTTCCTGAAGTACGTAGATG
ACATAGAGAAAGGGAACACAATCAAGAGGGTGCACATTCA
ACGTAAAAACAGGGGTCCAAAGTACAGCACACTGCCTCGC
AACTTCAGCCTTCCTGGGCATGGCGCTCGACCTCTAGCCA
AAGATACGTGGGCCAATACCTCCACATTAGGGTCCAAACC
CAAGTCACGTGTCACTGAAGTCCAACAACTTTTTGAGTTC
AGAGCCAGTGATGCCACAGGTGGTAGCAGTAGCATCAGTG
GAAGTTCTGCCACCAGCCAGTCAAAGATATCTGGGAGTAG
CTACCTCCCCTCACCAAAGGTTGCAGAAGAGTCTCAAGTA
CAGACCTCATCTCAGAATGAACAATCCATAGGCCTTAGTG
TTAGGCCTCACCTGTTAAGAGCCTCCAGTATGCCTGTTAA
TGTCCCACGCAGAAAAGGATCAGATTCAACTGATGAGCAA
AGTTCCCAGTCTCAAAATGGCTCAACTGAGAAGCTTTTTC
GACCGGCTGATGGAGGTGACAGGAGAGGCAGCATTCCCCA
GGACAGGGCCAGCTTGCATCAACAGATCACAGCTGCACTT
AAAAGGGTGCGTGAATTAGAAGAGCAAGTCCGCACCATCC
CAGAATTGAAGGCTCAAATATGTTCACTTAGAACAGAAAG
GGAAGGACTGCTTCAAAAAATTCTGCAGCACCAGTCAGAA
CAAAAGAGACCTTTGCAGCTGAAAGAGATCGAGGTTCTTC
AAGCTGACTTGCAAGTGAGTGCTTTACCCCCATCTACAAG
TGGGAAGGAAGATGCACTTTTCCTTTCCAAAAACAAAGTT
GCTGATCATGAAATCGTTCATGAAGTGCCCTCTGACAGAT
CCACAGAACAGCTCCCAGAAAAACCACATTTTGAAGTACA
GCTTAATGTACAACCAGATTCTAAAATAAACAAACCTGTA
ACTGATACAGAGTCAGAAAAGGAACAAGTGCCAGCTCCTG
TTTCTGTCCCGGTGATACTCATAGACAAAGCAGAAACTCC
AACTGATCCTGATGAAGAAGAGGAACTTTTGCAGGAACCT
ACACTTCAAGAAGAAGCATCAAAGAGTCCCTCAGAGCAAG
TAAAGGAGCAGGAGAGATCAGAGATTTTGCTTGAAGATAA
ACAGCCAACACTGTTAGAAGGGATTCCAGCTTCAGAATCT
GAATGTACATCAACTCAAGAAGTTACCATGACTGTTCAAA
GACCAAGTGTAATTATAATTGAGGAGAATACAACAGCCCA
ACCTGCCGAACAGCAACTTGTCTCTAACTTGGAGCTGGAG
GCAAAATTGAAAACTTTGGAAGAAAGTTTAAGCAAGGCAA
GCTGTGAACTGGAAAAGACAAATGTCTTGCTAAGAGAAGA
AATGGATAAAAACAGACAAAAGGATGAGAGAATACAGGAA
CTAACTGACCAAGTGAAAGAGCAGATTCTTCAAGGTCCTA
TTGAGACAGAGCCGCAACCTGAACCAGTTGTCAAATGTGA
TGCATCGGTTAGTACAGACAGCAAAAGTGTCCTTGAGAAA
GGAATCTCAACAGAACCTCAACCAATTGAGGATCCCAAAG
TAACTGAATCTCAATGCTCGAGCACTCAAACAAATATAGT
AGAAGCTCGAGACATTGAAGTGCTTGCACAAGTCACTACA
GCAGAGAAAATTGTAGGGGTAGAGGTAGTCATGTGTGACC
AGTCAATAGAGACAGATGTCCTGGACAATCTAGAAGGCAA
CAATAGTCTGGAAGTCTTGGAAATGCTAGAAAACACAGAC
TCTATAAAAAACAAAGAACAAGAGTGTGATATCAAAGATA
GTGAATTAAGCCAGATTACAGATACCAAAGTCAGTGAAAA
TGTTGCAGAAAGTGACACTGAAGAATATGTCATGGTAGAA
AGTGCTATGGTTGAGACTTTGGCTAGTGAAATTGAAGTTA
CTGAGCCCACAGTCCAAAAGACAGAATCTGCGGAGAGTCT
AGGCATTGAAAGCACAGTAACAGAGAAAGAAAGAGAAGAA
GGAAGTTCAGGTTTGCAAACACAGCAGGAACCAAAAGAAA
CACAAGGACAGGATCCCCACCCTCAATCTCAAAGGGCATC
TGAAGCCACAGCGTCTCCTGCTGCTATCGGCCAAGTTGTT
AATCGTATACAGGGACTTTTTAATGAGCAGTGGGCCAGTC
TGGGAAGTGGAGGCCAAGATGCAAAAGGAGAGAGCTCCCA
GAAACCTCATTCTTCCAAAATAAGCTCCATTCAAAGCCAC
CTGAGAGGGTCCCTCAGTGCCCTGTCTGCCTTTTACTCAC
CTGTTCAGAAAGGAGGGGCTGCAAGACAATCAGGCCTCAA
ATCCATCATGAAGAAGAATGACTGTCCTGACAAGCAGGGC
AATGGGGGAGCGAAGAAGAACTTGAAGTTTGTTGGCGTAA
ATGGAGGTTATGAGAGCACGTCCAGTGAGGACTCCAGTGG
TGAGGAGAATCAGGACGCGGTTGAGGAGGTGGAAAGCTCC
GAGCCTGAGGTGGAGCAGGGAGAGGAGGACAGTGGGGCGG
CCCAGGAGGAGGCTGCTGCTGCTGGGGAGCAGAGTGAAGG
GGTGCAGGCGGAGGGGACAGAGGGCTCTGAGGAGCCTGAT
GTCTGCCAGGCCTCCATGAGTCCCCAGGAGGAGCAGCCTG
TCAGTGAGTTAGTTGATAAGAACTTCATGGCTGCTTGTCA
TTTCCTGAAGGATCGCATGGCAGAGGTTTCTGCTCCAAAT
AAAGAAATGAGGCAGGTTCTGATGATGTTGTATCAGGAGT
GGTTTCGTGTGTCAAGTCAGAAGGATTCTCAGGCTGAAAC
AGTCACACTGTACCTCAGAGAGGTGGGCTTTCACACCCCG
ACTCTGCTGCGCTACATTGTGAACCTGGCAGATGGCAACG
GCAACATGGCTCTGCACTACAGCGTGTCCCATTCCAACTT
CACTGTGGTCAAACTCTTACTAGACACAGGCTTGTGTGAG
GTGGATCACCAGAATAAGGCAGGTTACACTGCTATAATGC
TGGCAGCTCTGACTGCGACAGAAAATCCTGAGGACATGGA
GGTGGCACAACAACTACTGAGAATGGGCAAAATCAATGCT
CGCGCCAGCCAGTCAGGGCAGACAGCACTGATGCTTGCGG
TCAGTCATGGACGGGCGACAATGGTGCAGGTTCTTCTGGA
CAGCGGAGCGGAAGTGAACCTTCAGGATCGAGATGGCTCC
ACTGCTCTCATGTGTGCCTGTGAACACGGCCATACCGAGA
TCGCCAAAATACTGCTGGAGAGACCAGACTGTGACCTGAC
ACTCACAGATAAGGATGGACACACAGCTCTGTCAGTGGCC
ATGAAGGCCTCACACACCGAGATCATTGATCTCCTGAACG
CTCGCTCTGATCCAGGACCAGTCACAGATTCAGCGGCCCC
GCTCTGAGTCCAGCAGCCTCGTCTTCATCTCTACTGCCTC
AACCCGACTTGCCGACCAGGCCCACGGTCAACATTAAGGA
GACAGCACTTACCAGTGAAAGAAACGGCCAGTGAGAAACG
CCAATAACAGATGCCATGGAGGCTGGACTTCCCTAAAACG
TCCCCGATTGTCCTGAAGCACAGTTACTGGAGCTACTTCC
AGCAGGCGGATGGTACATCGTTGATGATACATGTTTTGGC
CTTCTATTTTCAGGTAATGTGACTATATTTTGTTAGTGGA
TCGAGCGTAATCTACGAATGTTGTTAAAGAAGTGATCAGA
TGCACACTATATTTATTTTTATTGCACTTTCCTGTAATTT
TCTCCCCGGAGATGTACCAAGGCCTGTTTTAGTATAACCT
AATGTGTCTTCCTACAGTATATGAGGGTTTTGGGGGTCAT
TCCTCTGCCTTTACAGGTGGAACAGGGAAGATTTTACAGT
CACACAGTTGTGTTGTTGTTAGTATGTGTCCTGTTATCAT
ATTTTTAAACCCCAACACAGAGCCAAGCACTGAGAAAAGT
AATCTTCAGAGGTGATTCAGAGGCCTTGCGTTTATTATAT
TGGTTATTTTTAGTCAAATTTTGTTTTAGCAAATTTTGTT
TTATTTGGCACATCTGCCAGTTGCAAATGAAAATGCTTTG
GTCATTGGTCAAAAATACTTTTTTCTTTTATTATTATTAA
TAATATTATTGTTATTATTATTAATATTATTAATATTACT
ATTGTTAAAACTAAGAAAAAGATTAAATCAATACAGAAAT
ATAACAATGTAAAAACAGTTTCTGTATTTTGTGATTCAGA
GGCGTTTTCTGTTAATTTACTGTAATGGGAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations