Transcript

kank4-002

ID
ZDB-TSCRIPT-141209-1807
Name
kank4-002
Previous Names
  • ch211-90h23.1-002
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000060138 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000060138|OTTDARG00000038180|ZDB-GENE-120423-1 kank4|no_translation CH211-90H23.1-002 LG_ CU570976.5 Danio rerio protein_coding PUTATIVE, 576 bp
ACCCAACGAAGGGGACCAGGCTCTCGCGCTTCTCGCAGTG
TACACCACGCAGTCTAACAGAATGCAGGCACACCAGCCCT
GGGAAGAAGCCTGGAGTCTGGAAATGCGAAGAAATAGAGC
AGCGAGCTCAAGAATGAGAGGCATGTCCTGTACTCTTTCA
GCCCCAGCTGAGCTGTGCTGTTTTTTAAATCACTTTACCA
CACTAAACCCTCCTCAGTATCAGTGACACACACACTACAC
TCCAGCTGGACACACATACACATGTCAGTGCAAAGCTCAA
GCAGCATACATATTGTATAGGCAATGTGGATAAACAACAG
CATAATCTTTTAGCATGCACTACTTTAATCCTATAGCATC
TGAACATGATGGGGATCTGTATGGGGGTGTTGGCTGCTGC
TGCTGATGTGTGTGTGTTAGTGTGCCTGACCCTGCGTCTG
CCATTGGATGAGCTCTGTGGAGGGAGGTGTGTTCAGCCTC
ACAGTATAGCGCTTGTTATGAGAGCCTTCTGCCGTCCCCT
TCCACAAACCTCAATAACAATATCGCAGAGGCTGAGTGAG
TGTGAGTGTGTGTGTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations