Transcript

pkp4-201

ID
ZDB-TSCRIPT-131113-2071
Name
pkp4-201
Previous Names
  • pkp4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054346 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054346|OTTDARG00000037953|ZDB-GENE-120411-14 pkp4|OTTDARP00000042692 pkp4-001 LG_none BX005272.6,BX950218.13 Danio rerio protein_coding NOVEL, 5604 bp
GTCGTACAAAATATTTATGATGCGCCGGCGAGTCTTCCCC
AAAGTTGTGTGGACTTTGTGTAACCCCAATCCTCTTAAAT
CCGACCAATAGAAGACTAAACGCATACATCAACCAATTCA
AAGTAACGAATTTGTGGGCGTTTATGCGCACTACGAGCAG
ATGGTCACTCATGTGACCATTTAAGGGGTTGTTGTTTTCG
CGGTGTAAACGTATTTTCCACGGAATTCGACGGGAACTCC
GTTTTTTCCGAATGAACTCCCGTTCGACTACATGGCAACA
CATTTAAATGCCCTGAAACGGCATCTCTCTATGTGGAGCG
TCTACGTCACGCGCTCTGACCCTCTTGCCCATGGAAGCGC
GCGAGACCAAGCCGGAGCCGCCCGTTCATCGCCTGAAAAC
ACCTTTGGAAAGAATGTCATCCCGGGTTTCTCTTACCAAT
GGATTTAATCGTCTCCACGACTAATTCGCATTTCGGCGTT
TTTGCGGGGAAATGCCTACTCCAAGGCAAAGCCCTGTGGA
GGAAAGGGAGGTGTTGAGCGGCGAGGGAAGATCCAACAAC
AACAACATGGCGACTGATACCACCACCACCACCACCAACC
TGCTGGCCTCGGTTAAAGAGCAGGAGCTCCAATTTGAACG
GCTTACCAGAGAACTCGAGGAGGAGAGACAGATTGTAGCC
AATCAGTTGGAGCGATGCAGGTTGGGGGCGGAGTCTCCAG
GTGCTGCAAGTGACAGCTCTTCTGAGAAGTCTCTTCTGTG
GAGATCTGCAGAATCCTCAGGTGCAGGTGTGTCTAAGCCG
TCGGATGGTTGCCCCTCACCGACATTTGGAGTCAGAGGTC
AAGGGTCACTTTACTCTCCTGAACTGGAACAGATCTCCCT
ACGTGAAAGGTCTGCTGCAAACTCGCGCAGCTCGACTCAG
ATGAATTCCTACTCAGATAGCGGATATCAGGAGGTGAGCG
GTTACTACAGTAACACGGTGACGCCCAGGCGGTCTGAAGG
GAGGTCACAGTCGACCAGCTCCGCCCCCAGCGGAAGCCCC
ACCCTCGCCATGAGCTCCAGGGCTGAAGGACAGGCCTCTG
CACAGGTGGGCAGCAGTGGGCGTGTCATGAGGCGGGTCAG
CTCTGTTCCCTCTCGTGCTCCATCTCCACTCTACACACCG
TCTCCACCTGCGTCCCGCCAGCCTCTGCGTACTTCTCTCG
GAAGCCCCTATGGTTCACCCATAGTCTCAGAGCCTCGTCC
TCTACCTAGCATATTTCCTGGCACCACCTTGCCTCCTGCT
TCCAGCCACGCTCCTGACCCGCTCCACTCCAGCTACCTAG
GGCGGCATGGAAACGGGACGGGGTCTGAGTCTGGGTCACC
AACACTCCTGCGAGCTGGAATGACTGCTCAGCCTCAGCAG
TATGGGACCCTGGGAAAGCACGATACACGTGCATATGAGA
GCACTCACTCTTCTTTTGGCTCTCGAGCCTATGACATCTT
TGAGAGGATGGTTCTTTCAAGACCGGACAGCCTTACAGGC
CTGCAAACCTCTTACAGTCAAAATAGCCAGTTAGGCCAGG
ACACACGCTCCCCTGACTGCCATGTCACGCCAATCTATGA
AGACAGAACCTTCCAGAACCCTCTGTACCAGAGTCCAACG
CACGGCTCCCAAAGCGCTGCCTCCAGAAACAATACAGGGT
TTGGTACTTTACAAAGGACCACGAGTCAGTGTAGCACTCT
GAGGTACCAGCGAGGGTTATTCTCTATGGGCTCCATGGCA
ACGCACTCTGACACCTATCGTCCTGGACATTATCGCCAAG
CCGATTCGAACTACTCCAGACACTCAGCTGCCCTTGACAA
CGCCGTCACTCGCTCGCCTTCCATAGACAGTGTTCACAAA
GATCCCAGGGAGTTCGCCTGGAGAGATCCTGAGCTGCCGG
AGGTGATCCGGATGCTGCAGCATCATTTCCCTTCTGTTCA
GGCCAATGCTGCAGCGTACATACAGCACCTCTGCTATGGA
GACAACCGCATAAAGGCTGAGGTGTGTCGTCTTGGAGGAA
TCCGCCACCTGGTGGATCTGCTAGACCACAAAACACTGGA
AGTTCAGCGCAATGCCTGCGGAGCACTACGCAACCTAGTG
TACGGGAAAGCCACAGATGACAATAAAGTGTGTGTGAGGA
ACTCTGGCGGAATCCCAGCTCTGGTTCGTCTGTTGAGAAA
AACTCCAGACAGCGAAGTGCGAGAGCTCGTAACCGGTGTT
TTGTGGAACCTGTCTTCGTGTGATTCTGTGAAGATGACGA
TCACTCGAGACGCTCTCGGGCCTCTCACCAACACGGTGAT
CATCCCTCATTCTGGCTGGGGTGCGGCCCCTCAGCGGGAG
GACCAGAAACTCAAGCTGCACTCCTCTCTGGTTCTTAGGA
ACACCACCGGATGCCTCAGGAACCTGAGCTCAGCTGGAGA
AGAGGCCAGAAGGCAGATGCGTTGCTGCGAAGGACTGATT
GATTCTCTCCTTTATATAATCAAAACATGTGTAAACACCT
CCGATTATGACAGCAAGATTGTGGAAAACTGTGTGTGCAC
TTTGAGAAACCTGTCATACCGTCTGGAGCTGGAGATGCCC
CCGTCTCGGCTCATGGGAACCCAGGATCTAGACACTCTCC
TGGGCCCTGACACCTCTAGTAAACAGGCCGACTACAGCTG
CTGGGGTCTCCGAAAGAAGAAAAAGAAGAGGTCCTGGCAG
GATCAGCAGTGGGATGGAGTGGGGCCTATTCCAGGATTTT
CTGGAAGTCCAAAGGGGGCCGAGATGCTGTGGCATCCGTC
TGTGGTAAAGCCGTACCTCACTCTGCTGGCAGAGAGCTCG
AACCCGGCCACGCTGGAAGGAGCAGCTGGGTCTCTGCAGA
ATCTCTCCGCCGGGACCTGGAGGTTTGCGTCCTACATCCG
CGCTGCTGTACGTAAAGAGAAGGGTTTGCCCATTTTGGTG
GAGCTGCTAAGAATGGATAATGACAGGGTGGTCTGCTCTG
TGGCTACTGCGTTACGAAACATGGCTCTGGACGCCAGGAA
CAAAGAGCTCATCGGAAAGTACGCCATGCGGGACCTGGTG
ACCCGTCTGCCTGGCAACGGGCCCTCGCTGCTGTCAGATG
AGACGGTGGCGGCGGTTTGCTGTGCGCTGCACGAGGTCAC
GAGCAGGAACATGGAGAACGCCCGAGCGCTCGCCCAGACC
GGCGGCATCGACAAACTGGTTACAATCAGCAGAGGACGCG
GAGAGAGGTATTCCATGAAGGTGGTCAAAGCAGCAGCTCA
GGTGCTAAACACTCTCTGGCAGTACAGAGATCTGCGCACC
TTCTACAAAAAAGATGGTTGGAACCAGAATCACTTCATCA
CCCCAGTATCAACGCTGGAACGGGACCGATACCGTTCCCA
ACCGACTCTGCCAACCAGCAACGTACAAATGTCCCCTGTC
ATCCAATCAGGAGGCAGTGCCACCTCTTCTCCTGCCATGT
TGGGTATAAGAGGTCAGCGTTTAAATCAGCGAAGGACCCA
GTCGTCTATGCAACTTCATAACTATTATGGAGACGCCAAC
AGAAACACAAGTCAATATACAGGGTCTGGGAAGCAGTCAG
CCTATTTCATCAGTTCCTTTCCCTCGCCTTCAGCGGAGGA
GTCCCGCAGATCACAGCACGGCCGGCTTTACTACCCAGAG
GAGGTCAATCAAGGCACCTACGACACTTTCGGGATGTACC
TGTCGTCTCCATTAGGCTACGAGGACGCTTACCTGGACGA
GCCGGTCCGATATCCTGTGGTGAGCGAACGGCAGGTGCTC
AAACCCAACACCAACTACGTGGACTTCTACTCCACCACAC
GCAGGCCTTCATACAGGACTCAGCCCTACCCCGCCTCGCC
CGACTCATGGGTGTAGGCATGTACACGTGTGTATTTGTTC
ATGTGACGTGTAGCCATAGATAGAATATTACAAGGAGGAG
TTTCTCCGTTAGACATATCTGGATCAGTGGATTCCAAGAG
CTGTTGCATTTGAAGTGACTGGTTCATTTTCATTCAACAA
ATTTAATTAGTGTTATGAGTGTGTGTGCGCGCGCATAAGA
CGGTGCAGCGACATTCATTAATGTGTGTGTGGGAGAGTGT
GTGCGCGTGTGAATGACAGATTATATGGTCCATTAAATTA
ACTTGAATTGGTTTGACCTGGGATTGAGTGCGAGCCAAAG
ACTTTTACTTTTCAGCGTTTGCTGTTAAAGTGTGTTTAAG
GTCTGATTTACTGAGAACTTGAACCATTTTTTAATGCTTT
TCTTTCCTTATCTTTTGTTTGTTTGTTTTTTTTAAAAGGC
ATGTATTATAGTCATCTCGGTTTTCGAGCCAAATGAAAAG
GTGTAACTAAATTACGTATTGGCTGAGAGGTCTAATAATG
AAATAATAGCTGTGTAAAAGAGAAAAAAAGATATATATAT
ATAAATATATGAAATGAACACAAACAAAAAACACTAATAA
TGTTCTGTGCATTGAAAAACGAGCGTCATTTTGTCTGGTC
TCATTGCTGTATCCTACTTAACGTAAAGATTAATGTATGT
TCCATGGAGTCTTGTACAACTACGTCAGTTTATTGTACAA
CCGTGATCTGTGCTTCTAAGCACAACAACTGTGCCATGAT
AAATCGCTATGTAGAACTGTGTGTATATGTAAGAGACCTT
ACGGAGGCAAGCAGTTATTACTATCAGAATATTTAGATGT
AATAAAGATAACTTGGTTTTTTTTAATATTTGATGTCGGA
TTATGTTGTTTGTTCGCCTATTGTAAAGAGCTACAATTCA
ATTTCGCTTTCAAGTGGCTTGCGCAACAAATTGTGTTTTA
GCAGGGAATCCAAACACCCTGAGGACGGATTTCAGCTTTG
CAGTAGCTCTCTTTGAAAGAAGCAATTTATCTCGGTGGTG
TTAATCAGCTTATCGTATTTCAATGCCGAATCAGAAATGA
CACACGGTTATTTATTTATTTATCTATCTTCTTTAGCGTA
TTAATAAACAGTGGCCTTGAGCTCCTCACAGATTAATGGG
AAAGATGTTCCATTGTTAGCCACACGGGGACACTGAAGAG
TTGATTTCCTCATGAATAGAGCACAATAATATTTCACTTC
ATAAATATTATGGATATATATTATGGACTAGAGGTCTGAG
GGAGTAAGAACCCCTTGATACTTTTGATATTTATGGTTTT
ATTTGCTTCTGCTGAGTTATTACTGCTACTATGAACATCT
AACAGCACAGATTTATACGCTCTCAATCCAAAAAGGGTGG
TTGTTGTTTTTTTTTTTGGTGACTATAAAATTTTTGTCAT
GTAATATACAGTTATACTATAGTATTATAAATTAGAAATA
TGCCCTGGTCGAGCTCTTATTCTTATTCAAACTTTATTAT
TTACAAATTGGCTAGTCAATTAACAGGATGGAAAGTAAAA
GGATGCAAATAAAACATTAAGGGGATAGTTCAAGATATTC
TGAAGACTCCCAAGTTGGTGTTTTTTTCTACTGTGGATGT
CTACTAGTTGCCAACATTCTCCGCAATATCTTATTAAAGA
AATGTTAAATAAAGGACTGGAATTGTACATAAAGGCAAGT
CAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations