Transcript

zgc:175264-201

ID
ZDB-TSCRIPT-131113-1845
Name
zgc:175264-201
Previous Names
  • dkey-219e24.2-001
  • zgc:175264-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050526 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050526|OTTDARG00000035498|ZDB-GENE-080204-123 zgc:175264|OTTDARP00000039666 DKEY-219E24.2-001 LG_ CU207354.9 Danio rerio protein_coding KNOWN, 3261 bp
CACACTTGTCGTCTCTGCCAGCAGCAGCAGCGTCGTTGAT
GAGAGTGGGAACTTTAACAATCACTTCTCTTTTACAACAT
CTTATTTCAACGGCCGACCTGATCGAGCCGAATTAAAGAT
TTTCTGGTTTGACGTCAAATAAAGACAGCTCACAACTTTA
GACGGCTGTTTGTACATCTTCCAGAGCTGTTGATGATGTA
GCGTCAGATAGTTTTGGTGAAGGGGGGCGAGGTTTGTTTC
AGCTTCAGCAGAAAATGTTGACAAAACTCCTCACGCACTT
CTGAGGAAACTACAGTTTATTGAGCTTCAGGAATGGAATT
TCCAGTGAACCACACTGCTGTCTGAGATGAGCTGAGCTAA
TGTATTTCAAATATGGCAGGAATAGCATGGTATCAGAAAA
AAATTGGAGCTTATGATCAACAGATTTGGGAAAAATCACT
GGAACAGACTGAGTTTAAGGGCTTTGGAAACAAACTTAAA
AAGACTGGCCATATTAAGCCAGATCTCATTGATGTCGATC
TAGTAAGAGGTTCCACATTTAGCAAAGCTAAGCCAGAAAG
CCCTTGGACGGCTCTGACTCGTAAAGGCTTGGTTCGAGTC
CTTTTCTTTCCTTTCTTTTTTCAATGGTGGATCCAAGTCA
CGTCTAAATGCATCTCCACCCTCATTTTGGTTCTCTACGT
GCTTCAAGTGGCAGGAGCTGTGCTGTATTTTGAGGTACCA
GCAGCCTGTGCTAGTGAAGTTGTTGGTCCATTGTGTCTAA
TGCTGTTGTTGGGAACAGTGCATTGCCAAATAGTATCCAC
GGAATCCTCCAGAAGCCCAGACATCAGCCCTGTCCACAGC
CGGACAGCCAGCCCTATTCGCAGGAAAAGACAGAGGAAGA
GTAGAAAAGCCAAGAGGTCTGGGGATGAAGGAAGTCGAGT
AGCAGGGATAGTAGAACTCAAACCCTGGCAACTTGAAGAC
AACCATCGGCTCTACAGATCAGAGAAGACTCTGAACTCCC
TGAGGAGGCCTCCATATGGGGCATCTGAAGATCTGTCCAG
TGAAGAAGAAGAAGAAGAAGCAGAAGAAGCAGAACTACAA
AAAGAGAGGCTCTTTTCATCAGCGCCTCCCAAATATGCCA
GCGCGCTGAGAAACAGACTTCACAACGTTCCCAAGAACAA
TGTACAACCCCAGGCTCAGGGAGAGAGCAATGGCATGCCA
ACAGAAATCCCAGGGCTGCCACGTGAAGTTGAGCATCTAC
GGCCTTCAGAGGGATCGCATCCTGCTTCTGATACAGATGA
TATGTTGTGGGAGGAGCTTTTACAAGATTCTGACTCCGCC
TCCACAGGAAGTAGTGAGATTGGGGAGGACGAGCCTCACA
GTCAAAGCCACTCCCTTCCTGTGCCCACTATTGCTTTAAC
AAGTGATGAGGATGAGGATGAGAATGAGGCCTTACCGCAG
CACCAGTTTTCATGGCTGCAAGCTTGTCACCCATCCAAAG
ACCGTGTCAGTGCCATTATCTGGGAGCAAGGAGAGTGTAA
GAAAGCTGACATGTCGGTGCTGGAGATCAGTGGTATCATT
CTCACACGAGTAAAGGTGGTTGAACAGGGGATGGGTTATC
TGATTTTCGGTGGTCTGGTCACTGCATCACTGGCTCTGCT
GCCCTACTGCTTCAGACTGGCACAGAAACTGGATCTCAGT
GCGATTTCCCTGGAGGATCTGCCAGCAGTGGCCATCGGGT
CGCCTTGTGCCTTCTCCTATGCGTTTTTCATCATCGCCAC
TATGGAAAGAGTTTTCCTCTGTGGACTCTTCTTCTTCATG
ATGTGTGTCGCTGAGAGGACGTATAGACAGCGCCTTTTAT
TCGCAAAACTCTTCAGCCATCTTACATCTGCACGCAAAGC
CAAAAAATCAGAGATTCCTCACTTTCGGCTCAAGAAAGTA
CAGAATATCAAGATGTGGCTTTCCCTTCGATCATTCCTGA
AGAGACGAGGCCCTCAGCGGTCTGTCGATGTCATTGTATC
ATCAATTTTCCTCTTGGCTTTGTCTATTGCCTTTATCATC
TGTGCACAGCTTCTGCACAGTCACCACACATTTCTGGATT
CAGAGACCAACTGGGAGCTGGTGGTGTGGTGTGCAGCTCT
CATGGTCTTCCTCCTCCGTCTCGCAACACTTGGAGCAGAG
ACCAACCGAAAATACAGCAATGCTTCTGTGCTTCTGACTG
AACAGATCAACTTGTATCTTAAAATGGAGAAGAAACCCAA
CAAAAAGGATCAGTTGAACATAGTGAACAATGTGCTGAGG
CTGGCCACCAAATTACTGAAAGAATTGGACACTCCATTTC
GTCTGCTAGGCCTGACGGTGAACCCGCTCATCTACAATAT
CACACGAGTGCTCATCCTGTCTGCCGTTTCTGCTGCTGTC
AGCGATTTATTAGGGTTCAACATCCGGCTCTGGAAGATCA
AACCATGATGACTTTTACACTGCCAGCGTCTTAACACTGG
GGGCCAGAGAGACTCTTAAAGCGACTAGATGACCAAGTAG
TTGTCTTTTTAAAAAACTGTGCAAATCTACTGACCAAACG
TATGCATTTTTTCTTTTGTACCCTGTACCTTTGGCTAGAC
TGAGCAAACCTGTGTTCAACTCTGCATTCTTGTTGAGTTT
TCCTCTTATTCCTTGAGTCGTTTAAAAAAGCACAACAAAA
TTGTAATGGCTTTTCTTGATGCACTTGCTTACTGTAACAA
CTTAACAGTTATATTACAAGCAGTGGTCGCCGTTTCCCAT
AAATGTAGCCACTGCGAGTGTATTATGTGGTTTGGATTCA
ACCACTTAAAACAGAACCACTATGTGCCTTGTGAATAATT
GCATATGACAGTACTTTTAGATAAGCTATTTATGAGATAT
GGATTTGTCAACTGCTGAATGGGGCAATTCAATTGAGATT
TTTAAGAAAAGGGTACTGAAAATCTTGCACACTGAAGCTC
TTGGAGGAGCACTTTCTACTGGCATTGTATAAAAATAAAC
CTTTCTCCAAGATTCTTCCTTAATCATCAATCCTTAAGCA
AATATTTGAGGTTTGGGAGGTTGAATAAATGTGAATGTCG
AATGTGATGGGTCTGGTGACCCTTCCTCCTGACTATTAAA
TATGCAGAAAAAGCAAAAGAGTTCTATTTATTTTTGTTTC
GTTATTGTTAGTTTCTGTTTAGTTACAAGAAATGTAAATG
TGTTGATTTGAGTTATTTTTAAGAAACTATTTTACGTTAT
AATAAAATACGTTAAACGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations