Transcript

iqsec1b-201

ID
ZDB-TSCRIPT-131113-1819
Name
iqsec1b-201
Previous Names
  • dkey-57n24.7-001
  • iqsec1b-001
  • si:dkey-57n24.7-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050242 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050242|OTTDARG00000035323|ZDB-GENE-120813-1 iqsec1b|OTTDARP00000039437 DKEY-57N24.7-001 LG_none CU467888.19,CR847934.9,CR933786.10,AL928964.7 Danio rerio protein_coding KNOWN, 7336 bp
TTTTATTTGTAGTATAACATCTGCTAATTTTAAAAGGGAA
AGATATTTTTAGCTGGTCGAATGGGGAATGGGGAGAACAA
CTTGGCCAAGCTAGTTAGGGCTCCTAAAGTCAACATACCA
CTGCTGTTTTATTTCAGCAGCTGGGAGACCTGCTTGATCA
CCAATACCAGTCTAATTACTCAACATAAAGCAAACAAAGC
TTTTATGTTTATGCTTTTAACTTGCATAAACATGTACCAT
GCTATCACTACTAGCGCAGTAAACACAGCTTACCTTCACA
GTCCTCCCACTGAAGGGTTAAACGGATTTAGCATCCACGG
AGCGGGTTAGTTATTGTGGCGCAGCGCAGAGCCTCTGGAC
GGCGCGCTGCAGCGGACGAGCGCTCGAGCGCAACTTCAGT
ACTCAGTGCTGAGCGCCGACAGCAGTCAGCAGTACCAGCA
AACATAAACAATGGCGGAGCGGCTGTAAACCCAGCTCAGC
GGATCAAATTTGCCCCATGGACGGGCATTTCGCCTACATC
GACATGGAAAACCCGACCGAAAACCCCAGCAAGGCGGCGG
AGTACCTGAAAGAGCTGAATAAAATCATCGAAACCCAACA
GGAGTTGCTGGAGAAGCAGAAGAATAGGATTGAAGAGCTC
GAACAGCAAGTGTGTGATCTTTGTCAAGAAAACGCGTGCT
TGAAGGATCAGCACCAGAGGCACCTGGCCACCTGCAGACT
GCAACAACAGGGCAACAGTCACCCCACGCTGGGTGCCATA
AAGGAGAATGTGATCCAAGAAAAGAATGAAAGTGAGGGCC
TGCGTGTCTCAAATGTCAGACGGCACGCTTCTTTGCCCCT
CGATGTCACAGATAACCCTGGCAACTTTATTGTGTCGCAC
TGTCAAAGAAGTTACCCCTGTCGCAAATGGAAGTCTGCAT
CTCTTGGTGTGGAAGGTGAGGCTCCGGGCGGCGAGTCGGG
CCCCTCTCTGGACAATAGTGGAGGTTACTTACGAGGACCG
GTGAGCCGCAGTGCTATCATCAGTGGCGAGCACTTTGACG
GCCCACCGTTGTACGCTCACGAGGTACGGCAGCGCCCACG
GAGACCCAAACTCCAGCATTCTCAGTCCATTCTCCGCAAA
CAGGCTGAGGAGGAGGCCATCAAACGCTCCCGATCGCTGT
CTGAGAGCTATGAGCTCTCCACCGACCTCCAAGACAAACA
GGTGGAGATGCTTGAGCGGAAGTATGGAGGGCGTTTTATA
ACCCGACATGCTGCACGAACAATCCAGACTGCATTCCGCC
AGTATCAGATGAACAAGAACTTTGAGCGCCTCCGGAGTTC
TATGTCAGAAAACCGCATGTCCAGACGTATAGTTTTATCC
AATATGAGAATGCAGTTTTCATTTGAAGGACCTGAAAAAG
TCCACAGTTCATACTTTGAGGGCAAGCAGGTGTCACTTAC
GGATGATGGGTCTAAACTAGGAGCATTGGTACAATCTGAG
CGCGGTGAGATGGTCCCCGCCAACATGAAGTCACCTGCGG
TCCAGAGCGATTTCACAGACGCCATTACAGAACTGGAGGA
TGTTTTCTCTCGACAAGTGAAGTCATTGGCAGAATCGATA
GACGATGCACTGAACTGTCGTAGCCTACACGGAGACGAGG
GACAGTCAGAAGCAACCAGAGGTCATCCAGACTTGGAGCA
AGAGGTTACCTACCAGGTCAAGCCTTCCCACGGTAGCGAG
CACCGAAAGCGAGATGAGATGACAGCCTCCTACAGCGATG
TGACACTTTATATAGATGAGGAAGAGCTCTCGCCACCTCT
TCCTTTATCACAATCAGTTGACAGACCCTCTAGCACTGAG
TCAGACCTCCGTCTACGTTCTTTGAACTCTTCGCAGGACT
ACTGGTCTCTAGCTCATAAGGATGAAAAGGCCGACACGGA
CACTAGCTGCCGCAGCACCCCATCTCTAGAGTGTCAAGAG
CAAAGATTGAGAATAGACCACCTTCCTCTGCTCACTATCG
AACCTCCGAGTGATAGCTCTGTTGAGTTGAGTGACCGCTC
TGACCGAAGCTCTCTCAAGAGACAGAACGCTTACGATCGA
GGCATAGCCAGCCAGCAGGGCAGCCCTAAACACATCCCTT
CCCATGCACTCCCACCAAGGGGGCCAGCAAGAGAGGATGA
AGCTCCACGCCATCGGCCGCGGCAGCTGGAAAGCCATCTG
GCTATCAATGGCACCGCCAACCGGCAAAGCAAATCCGAGT
CTGACTTCTCTGATGGTGATAATGACAGCATCAACAGCAC
TTCCAATTCCAATGATACGATCAACTGCAGTTCGGAGTCC
TCTTCCAGGGACAGTCTTCGAGAGCAGACTCTCAGTAAGC
AGACGTATCACAAGGAGACACGAAACAGTTGGGACTCGCC
AGCATTTAGCAATGATATCATCCGCAAGAGGCACTATCGA
ATTGGCCTGAACCTTTTCAACAAGAAACCTGAAAAAGGCA
TCCAGTATCTGATTGAGCGAGGATTTGTCCCAGACACACC
TGTGGGAGTTGCCCATTTCCTGTTACAGAGAAAAGGGTTG
AGTCGACAGATGATTGGCGAGTTCCTGGGCAACAGGCAGA
AACAGTTCAACAGAGATGTTCTTGACTGTGTGGTAGATGA
GATGGATTTCTCTGCAATGGAGCTGGATGAAGCCTTGAGA
AAATTCCAGGCACATATCCGGGTGCAGGGAGAGGCACAGA
AAGTGGAGAGACTAATTGAAGCCTTCAGTCAGCGCTACTG
CATCTGCAACCCGGGGGTGGTACGGCAGTTTAGGAACCCA
GATACCATCTTCATCCTGGCGTTTGCCATTATACTCCTCA
ACACAGATATGTACAGCCCGAATGTGAAGCCAGAGAGGAA
GATGAAACTAGAGGACTTTGTGAAGAACCTTCGCGGAGTG
GATGATGGAGAGGACATCCCGAGAGAGATGTTAGTGGGCA
TCTATGAGCGAATTCGTAAACGAGAGCTTAAGACGAATGA
AGACCATGTGTCCCAAGTGCAAAAGGTGGAGAAACTCATC
GTGGGCAAAAAGCCGATCGGCTCTCTGCATCATGGCCTCG
GATGTGTTTTGTCTCTGCCACATCGCAGACTGGTCTGTTA
CTGTAGACTGTTTGAAGTCCCGGACCCCAACAAACCTCAA
AAACTGGGTCTCCACCAGAGAGAAATCTTCCTGTTCAATG
ACCTTCTAGTGGTCACTAAGATTTTCCAGAAGAAGAAGAA
TTCGGTGACGTACAGTTTCAGGCAGTCCTTTTCTCTCTAC
GGGATGCAGGTGCTGCTGTTTGAAAACCAGTATTACCCCA
ATGGAGTGCGTCTCACTTCAGCTCTTCCAGGCGCAGACAT
CAAGGTTCTCATTAACTTCAATGCCCCAAACCCGCAAGAC
CGTAAGAAGTTCACTGATGACCTGCGTGAGTCCATCGCAG
AGGTGCAGGAGATGGAGAAATACAGGATAGAGTCTGAATT
GGAGAAGCAGAAAGGTGTAGTCCGTCCTAGCATTTCACAG
AGCTCAGGGTTGAAAAAAGAAACGGGGAACGGCAATTTGA
GTCGGACCAGTCTGGATGATAGCTATGCCATGGGGGAAGG
CCTGAAGAGAAGTGCCCTCAGCAGCTCCTTACGTGACCTT
TCAGATGCAGGCAAGCGGGGGCGCCGCAGCAGTGCAGGAT
CTCTAGACAGCAATATGGAAGGGTCCATCATTAGCAGCCC
CCACATACGGCGAAGAGCCACTTCCAGCCGCGACTGTCCC
TCCCGCCAGCAGTCTATCCCCAATTCCTCCTCTCTGCTGG
GTTCTCTATTCGGCACCAAACGAGGCAAATCTCCCTCCCT
GCCATCCCAGTCGTCCCACCCTTCCCATCCAACACTCATC
TCTCACACCCCTCACCCTTCTAACCTGCACCACACGGCCC
GCGACGGCGTCACCGTCACCGAAACCCAAGCCCAGATGCA
CCCGCACCACGCTCAATTCTGCCACATGCAGAATCCCCCT
CCGTACCACCACCACCATCACTACCACCCTCCAGCGCACA
TCCAACACCCACCCCACCAGTACCACCCTCCACCCGGCCC
CTCATCCTCTCACAGCCACTCACACAGCCAACACGGCCAC
GGTCCGCATCCGTCCCACTCATCCCACCCGTCCCACTCCC
AGCATGCACCACACCACCACAGCCAGCCTCCAGCGCCTCC
ACCCGCGGCCAGCAGCACCAAGCCCAAACACAGCGGCATC
AGCACTGTGGTTTGAGCCACTCCACGAACTCTTTCCACTC
GGGAATGGGACTGTTTTAGATCGTTGCTGCGAACAAAAGG
GCACCTTGACTCACGTTTCAACCCATCCAGCGCCCGTTTC
CCACTGGAAGGGGAGCCACACTGTGTAGCACCGGCCTTCA
GGGGGGACGGCTAGAACTCAAATCATCAGTTCTTACCAAG
TCATCGCTCAAGCTGTAGAGCCCCAGACAAAAACTGCGGC
TGCTGCTTCTTTTAGGCTCGATTTTAGAGACTTTGGACCC
TTTCGACGTTGGCGGTGAAGCAAAGAGCATGCGCAAAAAG
ACCGTGGCAACTGTTTTCTTGTACTTAATTACCTAAAATG
CATTATCAAAAGTAGCCTGCTTATTAGTTTGCAGAGACGA
CAGGGTCTGTCGGATTCGGTCACAACGAGTGGTGTTCCAG
TATTTAATGTAGCTGTAGACCACACATTTCTGTGATAGAG
ATTAGGGGACTATAACGTGCCAATTATTAAAAAGCAGTTG
AGTGAGTTATTCAAAAAAGAAAAGATTTGCTTTGTGTATG
TCGTGCATATAGTATTTTGTAAAATAATGATAATAATATT
AGCAGCTATTATTATTATTGTTATAGAACAAAAATGATCC
GAAGCCTCAGAATTAAAAAAAGAAAAAGAAAAAAAACAAC
TCTCAGTATTCTCTGTGTACTCTCGACGTAGTTTTCCACT
CAGTAGGTGGCCGATTGATTAATATGGAAATTATTGGTTG
CCTTTGGAGCTGGAAGATTCTTCCCGAATCTCCAGCTTGT
GTTCGCTCCGCCTCCTTTTTGGGGATCCACGTAGCGCAAA
CCAATCACAGGGACTGTAGGAAGTCATTGATGGATCCTCC
ACGGCCTCGACTCGTCGGGCCACTGCTGCAACATGGTTTT
ATTTTTTTAACTATTTTTTTAGAGATGAATAAAACAATAT
GAAATAATTGTACATTTGAAGATGTTTATGGTAAAGCCGG
CGCGCGCGGCGGAGAAGGCTATTTTGACGTAGCGTTTGTG
TCCGGAGAAATCTGATGGAATTCTCTCCCCATATTTCAAG
AGTTAGTTTGTGCAGAGATGTTGATTTTTCTCAGCAGGCT
GAGCGTGTGTGCCCTCTCCTGCGTGGAAATGATGTAGATT
TGATACATTTTTCTTCGGTCCTCCTGTGAGAATGCCTTTC
ACTTGCTCAGAAACACAGCTAATGTAATGTAATCTAATGT
AATGTAACTGCATATAATATGCAGCAGTGGGTCGGATGGA
TGTGTTCTCGCTCGGAACGGATTTGGACATGTTCTTTTTT
TTTTCACACATATCCCCCTTTCTCGGTTCAATTTTTGACT
TGTTTTATACTGTAAGTAAATCAATGGTGACAGAGCTGTG
ATTCGATGTAATAGTTTTGTGTGTCGACGCTCTCTTTTAA
CTCAAGCACAGAGCTTCTGAACAGCACTTGTCTTTGTAAA
TATTCACTTAATGTACAGAAACCACGGCTGAAATGAGCTC
GTTCTCTAATACGAGACCCTTGTGGCATTTGCTGTGCGAT
GTTTCTCTTGTTTCTGATTCCTTTTTGTTTCGTTTTTTAA
ATTAATCATGTGCAATATGTATGTTTCAGTTTTGTAAATT
CAGAATTGCGACCAACCTGTTTGTTCGTTTGTCGTTTTTA
ATAATTTCTAATATCATGCATAAAAAAAAAACATTTTATG
TTTCTCGCCCCCATCGCCATCTTTGTTGGTCTCTGTTTTA
CCTGCAACCTACAGTCAGGAATGTCAACTAAAGTACTCTT
TGCATGTATAGTGTACAAAATAATCTCTAGATATTGCATA
CTTCCAGAGATATTATCAGTGTTACAGTTGACCGTTGTTA
AATGAGTGATGATGACGATGATGATGATCATATTAAAATC
TGTAGACTTCTCTTCATTCAAGACGTCTGTATCCTGTTTC
GTACTGAAATAGATTCAATTAGGACACATCTGTTTGTTTA
CCTGGGCTTAAAAATCAAATACCGATCGTCAAATAGTGTT
TAAACCAACGTTAGCCTAATCGTAATCAAGCGCCACCAGA
GAACATTAGTATAATAATAGAAGCTTATGGATATTAGAGC
ATAAATCTGTGTCTATATCAGACTTCATAACACCTGGCTT
GTTCCCAAGATACACCGAGGCCAGTAATTTGTACAGAACA
CCATTAATCAGACTGTGTATGATCATCTGAAGCCATTTCT
GACTAAACAACCAAATGAGTACGTCTCTTTCTACATTTTT
TTTCTCAACTTTGTGTTGATTGTTTTTTTTTTTTTTTAAG
GATTTCAGTGCAGTGTTTTTGTAAATGTAATGTGGTGCTT
CAGCTTTGTACTGTATCGGACAAGTCAAAATGTCACAAAG
CTTTTGCATGCAGCTGATGCCTAGCACCTCTGGTTGAAAT
GTAAGCTTATTTAAAAAAACGAAATGAAGAAATGTGCTTT
CTTTTAATTATTATTTTTTTTCTAATATTATGTTTGTTTG
TTTGTTTGTTTGATTGGTTGGTTTTATTATTTCATTTAAG
CTTGCTGTTACATTTTACACCGTGCCACAGCATTTTCGGC
ATGTATATCACTTGTTGTTTGCCCTCCTAAAACAGATCAT
TTCTTTCTTCCCTCATGTAAAATCACTGTATATATCACAA
ACCAATGTGAGAAATTAGAAAGCATATCATATATAAATCT
AATATGGATGATAAAGGGAAAGTCTAAGGGGGTTTAGCGT
GTACATAGCCTGTATTATACTTTTTTGTTTTTCACTCAGT
CATCGCATCGACGGTGTAGTCCTTTTCCACTTTCAAGAGA
CTCATAATAACACTGCTTCTGCTACCAAATGTACTTTGAA
TTTGTCATAGGATCTTCTTTAATAAGCCGACTGTTACATG
ACTCTCACCGCCTTCCACTCAAACATTCATTTCATTTTTT
TTTTATTACCAAACGAGGAGAGGAGAACTATGGTTTTAAT
ATGCATTCTGTTTCTAAGTAGATGACGAGACCCTATTGAT
GTTTAACTATAACTGTGACCATGTTGAGAACATGAAATAA
AACAATATACCATCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations