Transcript

efcc1-201

ID
ZDB-TSCRIPT-131113-1818
Name
efcc1-201
Previous Names
  • efcc1-001
  • dkey-57n24.4-001
  • si:dkey-57n24.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000050239 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000050239|OTTDARG00000035320|ZDB-GENE-120813-3 efcc1|OTTDARP00000047443 DKEY-57N24.4-001 LG_ CU467888.19 Danio rerio protein_coding NOVEL, 2450 bp
CAAGAGTGGGGCGGTCTGGTGTTCAGATAACATGAACTTG
GTATGCTGTTTGTATGCTTAGAGGATCTGCTGAATCCATT
AATCCATTTAGCCTCTATAAATGGAATTCTTGTGAAGTAA
AAAAGGATGGAAAAGTTGGACGCATGCGATCCATACAGCC
GACCCGCGCGCAGGACACAATGGATAGTGAGCACCCTGGC
GTATCATTACGGACTAGACCGTGGAGTGGAAAACGAAATT
ATAGTCCTCGCAACCGGGCTGGATCAATACCTCCAAGAGA
TATTTCATCACCTAGACTGTCAGGGAGATGGGAAAATACC
AACGGAGGATTTTAACATTCTTTGCGAGATTTTAGGACTC
GGTAAAGACTGTGATCTTGAGGAGTGCGCGGGGATATTGG
ATAATCTACCAAAAGAGTTCACCTTCAGGCAGTTTCACGC
AAAACTCTGCGGGTATTTCAGCACCAAAGCTGGATGTCAT
TATGAGAATGGGAGATTGCTGGTTGGTAAGGAGAGCGAAC
ACATAGAGACGCAGATCAGACTCCGGAGCCCTCTGAGGCG
GCGCGAGAAGCTGCTGTCTTTGGGTACCACCAGTAAGAGG
GAAAGCGAAGAGACGCCTTCTCCCACAGTAGACAGACACA
GGTCGGGTCGTAGGCAGCTGGGATCCTGCACACGAGAGTG
TTACGAGGAGATCGTGGCCCTTGAGGAGGCCGAGGACAGG
ATAGCCAAACTCGAGGAGGAAAACGCCAGTCTTAGGGAGT
TGGTGGAGGACATGCGGGCGGCTCTGCAGAGCAGTGATGC
GCGGTCACTGGCTTTGCAGGTGGGCCTGTGGAAAAGCCAC
TCGAAACATAAACCAGAAGGTGGCTGTTTCATCGCCCACC
AACGGAGAACAGTCCAGAAGCCCAACATTTCCGGTAGTCT
GAAGGACATCCAGAGTTTCCTGAGAGAAGTGGAGTTGCTC
CGGGCGTCCCGGGAGGGACAGGTCGAGGAGGCCATGTTCT
TCAATCAGAAGCTGGAGCAAGAACTGCGAATATCACGTGA
GACGTCGCTTATGCTAGAGGAATGTAACAGGACTTTAAAA
AAGGAGCAGGTGGAGATGAGGAAGAGGGTGGAGGAAGCCA
GACAAGCTGTGCTCAGCGGCCTTAAAAAAGTGAAGGAGCT
AGAGACCAAAGCCAGTCACATCCCTGTCCTGCAGAGGCAC
ATTGAGCAGCTCGAGATGGAGCTTCTGTACTACAGATCTG
AAGTGTCTAAAACATCAGTTGCATTCATCCACAAACTGGA
CAGACGGTATAATGGGGCCAGTCAGACGGTGTCCCGCTGT
TGCCTGGATACAGAGCAGGATCGACACTCACCAACAGGAC
GGGCAGAGACTGTGTCCGACACCATGGAGGAGCAACTGTT
TCGTTCAGTGGAGGGTCAAGCTGCGTCTGATGAAGAAGAG
GAGAGATGGACAGGAGAACAGCAGAGACAGGTGGACGAGG
TCAAGAGAATCCTCACCAGACTGTCCTGCTGCGGAGACAG
GTGTGATGAGAAGGCAGTGAAGAAGCTGTTGTCTCATTTT
GGAGATTCTCGCACAGAGGAGAGCCAGACGGCAGTGTTAG
AGCTGCTGGAGAAGGTCACAAGACTCAACAAACAACTGGA
GCTGAAGGAGAGTCAGGCCAGGAGGGCAGAGATGGACACT
GACCAGATGAGGGATGCACTGGTGCAGGAGCTGCAGCAGA
AGGCTGAGGAGACGGAGCTGCTTCACCTGGAGCTGCAGAT
GCTGGAAACAGAACGGGTGCGTTTGTCTTTGGTGGAGGAC
AAACTGATGGATGTGCTGCAGCTTCTCCAGCAGCTGCGGG
AGCTGAACGTGTCCAGAAGATCTTTAGGAAAGATTTTACT
CAGCACATTGGAGTCCTGCAGTGATCCTCAGCATGGGAAA
GCGCATATTTTAGAGGTGCTGAACGCTCTCTGTCATGAAC
TGGCCGCGTGTGAAATCCTGTCTAACGGCGAGACCATAGA
GAGATCACAGAGTCACCAGTCTCTCACCAACTCGCTGCTC
ATCTCCTGCTAAATCTCCGTTACATTGCTGCCATCTGATG
GTCAATGGATGATACGCACTAACTAACAAGCCACGTTGGG
CAATGGGACCAAAATTAGCCATGCATTTGTCTTTGTTTAT
ATGTCTGTGTATAGTTGTTTAAATCATTTAGCTCATTTTC
ATTTATAATGACACATATTTCTGTAAATAGTTTGTGTAAA
TCATTTAGCGTATCATTTAGAATGAAACACATTACTCATT
TTAAACAAGGTAAGACACTGCAGGTAAATATGGTGAAAAA
AAAAAGAAATAAAATTAATAAATTGTAAATAGTTAGTTGC
ATACTTTCCCGGTTAATGTATTATACTTAGTGGTGTAAAG
TAACAAATTACTAATACTCAAATTACTGTAATTAGGAAGA
AATTGTAATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations