header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-1793
Transcript Name: cant1a-201
Previous Name: cant1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049941 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049941|OTTDARG00000035137|ZDB-GENE-040426-2441 cant1a|OTTDARP00000039193 cant1a-001 LG_ CU570690.8 Danio rerio protein_coding KNOWN, 1873 bp
CGTGAGGTTTGAGAGTTCACGAGTCGCGCCCTGAATCTTC
AGGAGATTCTGGATTCATTTTTTTTATCATCTTCCTGACA
GTGTGGCAGCCGTCCCTCCCTAATGCCTGTTTCTCCAGGC
TATGCTCGCCTTAAACAAAATGAGCCTATGAACTCTCTGC
GCATCTCTGTTGGCGGGCTCCCGATGCTGGCCTCCATGAC
CAACACCACAGACTCCCGCTTCCGGATCAAATGGAAGGCT
ATTGTGGTGGTGGCGTCAGCGCTATTCCTCGTCCTCCTCA
TCTACATGCAGCTTCTGCCCTTTCACCCTCAGCCAGGCAG
CAGGTACAACTTGAGCTTGAAACATCGGAAGATGAGCGAT
GAGGAGGGCTACAATTACACTTACCCGCTCAGTCCACCAG
AGCGGACGGCCCAAGGCATACGCTACAGAATAGGGGTCAT
TGCTGACCTGGACACAAACTCGCTCAGTGACAAGAAGCTG
ACCTGGTTCAGCTACATGCTGAAGGGTCACCTCCTGGTGT
CGGAAAGTGGAGATACAGTGGCGGTCGAATGGGATCAGGA
AAGAGTGGTCTTGGAAAGCCACCTAGCAGAGAAAGGCCGG
GGCATGGAGCTCTCGGAATTAGTAGTGTTTAATGGCAAAC
TGTACAGCGTGGATGATCGTACAGGTGTAGTATATAACAT
TAAAGGACTTAATGCGGTGCCCTGGGTCATACTGCCAGAT
GGTGATGGCTCCGTTTCAAAAGGGTTTAAGGCAGAGTGGC
TTGCAGTGAAGGACGAGCATCTATATGTGGGGGGTCTGGG
CAAGGAGTGGACCACCACCAGTGGAGAAGTGCTCAACAAC
AATCCTGAGTGGGTGAAAGTGGTGGGATTTCATGGAGATG
TGGAGCACCATAACTGGGTTCCCACGTACAACTCTCTCCG
CAGCGCCGCAGGCATCAGTCCACCCGGATACCTCATCCAT
GAATCTGCAGCCTGGAGCGACACTCTGCAGCGCTGGTTCT
TCCTGCCGCGTCGTGCTAGCAGCGAGCGATACGATGAGAC
GGCCGACGAGCGACGCGGCACCAACATAATGCTCAGCTGC
TCGCCAGACTTCCAAGACATTAAAGTGAGGAACGTCGGGC
CCCTAAACCCTACACACGGCTTTTCGTCCTTTAAGTTTGT
GCCCAACACAGACGACCAGATTATTGTTGCTCTGAAGTCA
GAGGAGGACGCTGGGAAAATCGCCACCTACATTGTGGCGT
TTACCCAAGATGGCCGAATTCTGCTACCTGAAACTAAGAT
CGGGGATGTGAAGTATGAGGGACTTGAGTTCATTTAGTGT
CTGGACGTATTTTCATGCCAAGGATTGGTAAATGCCTTCT
TCTAGGTGATGTACATCTAGATTTGGGCATTGTAAGGTTA
AGAATAATGCCAAGTGTCTGATGGCAGCCAAAATGTGGTT
GTAAATATCGACTCTTAAAATTAAAGTTGACTCTTTAATT
ATTTTAAATCACCTGTCGGAGCCTTCATCAAAAGTTTTTT
TTATTGTTTGCTTCTCTGTCTTTTTCGAGGTTTAGCGTTT
CACGCCAGCACTGTACTTACAGTGTAATGAATGTAACAGA
TTGGATGAAGTGACAGACTCGAATAGTTTACCCTACAAAC
ATCACTGCAGTTGCCATGTGGTTTTGACGAATGTCTTTTT
TTTTTTTTTACTGTGAATTGTTTTGTTTTTTACTTTATTG
ACAAGTGTCTTAAACAGATCAGTTACTTTTTAAAAAAAAT
CTATAAATCTGAACTGTCACAAAATGAACATCATGTTTCA
TCGATTCACCAGAGCTATTTATTTGTTGTTGCTGTATTTT
GTTTCTGAAGATTGAAGGTTCATAAGAACGGCA

cant1a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cant1a-201 1873
cant1a-202 (1) 812
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cant1a-201 Contained in:

OTHER cant1a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000049941 (1)
  • Ensembl_Trans:ENSDART00000013376 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC068371 (1) 1942 bp
    CITATIONS (2)