header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-3399
Transcript Name: cant1a-202
Previous Name: cant1a-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049942 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049942|OTTDARG00000035137|ZDB-GENE-040426-2441 cant1a|OTTDARP00000039194 cant1a-002 LG_ CU570690.8 Danio rerio protein_coding KNOWN, 812 bp
CTGTGCATATCCTATTCAAAGTGTTGAAGCAGTGGCTCGG
CTATATCCTGCCACACTGAGGTTGCGCTGGTGTGGCAGCC
GTCCCTCCCTAATGCCTGTTTCTCCAGGCTATGCTCGCCT
TAAACAAAATGAGCCTATGAACTCTCTGCGCATCTCTGTT
GGCGGGCTCCCGATGCTGGCCTCCATGACCAACACCACAG
ACTCCCGCTTCCGGATCAAATGGAAGGCTATTGTGGTGGT
GGCGTCAGCGCTATTCCTCGTCCTCCTCATCTACATGCAG
CTTCTGCCCTTTCACCCTCAGCCAGGCAGCAGGTACAACT
TGAGCTTGAAACATCGGAAGATGAGCGATGAGGAGGGCTA
CAATTACACTTACCCGCTCAGTCCACCAGAGCGGACGGCC
CAAGGCATACGCTACAGAATAGGGGTCATTGCTGACCTGG
ACACAAACTCGCTCAGTGACAAGAAGCTGACCTGGTTCAG
CTACATGCTGAAGGGTCACCTCCTGGTGTCGGAAAGTGGA
GATACAGTGGCGGTCGAATGGGATCAGGAAAGAGTGGTCT
TGGAAAGCCACCTAGCAGAGAAAGGCCGGGGCATGGAGCT
CTCGGAATTAGTAGTGTTTAATGGCAAACTGTACAGCGTG
GATGATCGTACAGGTGTAGTATATAACATTAAAGGACTTA
ATGCGGTGCCCTGGGTCATACTGCCAGATGGTGATGGCTC
CGTTTCAAAAGGGTTTAAGGCAGAGTGGCTTGCAGTGAAG
GACGAGCATCTATATGTGGGGGGTCTGGGCAAGGAGTGGA
CCACCACCAGTG

cant1a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cant1a-201 (1) 1873
cant1a-202 812
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cant1a-202 Contained in:

OTHER cant1a-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000049942 (1)
  • Ensembl_Trans:ENSDART00000156522 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DN767969 (1) 828 bp
    CITATIONS (2)