ZFIN ID: ZDB-TSCRIPT-131113-1787
Transcript Name: ints1-201
Previous Names: ints-001, ints1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049868 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049868|OTTDARG00000035085|ZDB-GENE-030131-6523 ints1|OTTDARP00000039128 ints-001 LG_ BX908797.10 Danio rerio protein_coding KNOWN, 6866 bp
AACTCTTCCACTGCAGCAGAAGCACAAACAGCACTCGGCA
AATCATGTAACGTTAGCTGCCCCTTTTAACAACAACTGAG
TTACAGTGAGTTGTTTAACTTGTGGAAACTGTCACAATGA
ATCGACCAAAGCCAACAAGCATCAGGCGCCCTAGTAACAC
CAAGCCATCAGGTCACCCTCCTCCTGGAGATTTCATTGCT
CTTGGGTCGAAGAGTCAGAGCAGTGAACCGAAAGCAAACC
CAGCTCTGCTGAAGCCGGCGTCCACTGGTTTGCCACCAGA
CCGCAAAAGAGAGGCGTCTTCGTCTCTGCCTTCTTCCTCC
GGCTTGTCCAGTCTGTCCAAACGGCCCAAACACCCCAATA
CTCCTCCCAGCGCCCTCTCTCGCCTCGCTGAGGTGGCTGC
TGTGGACAAAAGATCAATTTCTCCCTCCATCAAAGAGCCG
TCTGTGATTCCTATTGAAGTGTCTCCTGCTGTTCTTCTGG
ATGAGATTGAGGCGGCGGAGGCAGAGGGTAATGATGACCG
CATTGAGGGGGTGCTCTGCGGCGCCGTCAAGCAGCTGAAG
ATGAACCGAGCAAAGCCTGACATGACGCTCTACCTGAGCC
TCATGTTTCTGGCCAAAATCAAGCCCAATGTCTTCGCCAC
GGAGGGTGTGATAGAGGCTCTCTGCAGTTTGCTCCGTCGT
GACGCCTCCATTAACTTTAAGGCCAAAGGGAATAACCTGG
TTTCTGTGCTCGCATGTAACCTGCTCATGGCCGCCTATGA
GGAGGATGAAAACTGGCCTGAGATATTTGTCAAAGTCTAC
ATTGAGGACTCTCTTGGTGAGCGTATTTGGGTTGACAGCT
CGCACTGCAAAACATTTGTTGATAACATCCAGACCGCCTT
CACAACCAAGATGCCTCCTAAGAGTATGCTGTTACAGACG
GAAACAGGGCGATCAGGGGGCGACCTCAGTGCAGGAAACA
GCCCTCATCCTTCCACTCCAGATGAAGATGAAGGTCAGAC
TGAGCTTTTAATCGCTGAAGAGAAACTGAGTCCTGAGGAT
GATGGACAGGTCATGCCCAGGTACGAGGAGCTAGCTGAAA
GTGTGGAGGAATACGTCTTGGATGTTTTGAGGGATCAGCT
GAACCGTCGCCAGCCCATGGACAATGTATCCCGAAACCTT
TTACGCCTGCTCACGGCCACCTGTGGTTATAAAGAGGTCC
GACTGATGGCAGTCCAGAGACTGGAGATGTGGTTACAGAA
TCCGAAGCTGACTCGGCCAGCACAGGATCTTCTCATGTCT
CTGTGCATGAACTGTAATACACACGGCTCAGACGACATGG
AGGTCATCTCCAACCTTATCAAGATCCGCCTCAAACCCAA
AGTTCTCCTCAACCACTACATGCTGTGTGTCAGGGAGCTT
TTGAATGCTCACAGAGATAATCTGGGAACCATGGTGAAGT
TTGTGATCTTCAACGAATTGTCAAATGCAAGAAACCCCAA
TAATATGCAAGTGCTCCATACAGTTCTTCAGCATAGCCCA
GAGCAGGCACCCAAGTTTCTTGCCATGGTCTTCCAGGACC
TGCTGACCAATAAGGATGACTACTTGCGGGCCTCGAGGGC
CTTGCTCAGGGAAATCATTAAACAGACCAAACATGAGATC
AACTTCCAGTCCTTCTGTTTAGGCCTCATGCAGGAGAGGA
AAGAGGCCACTTATGTGGACATGGAGTTTAAAGAGCGTTT
TGTCATCCAAGTGACGGATCTCTTGACCGTGTCCATGATG
CTGGGGATTACAGCTCAGGTCAAAGAGGCCGGGATTGCCT
GGGACAAAGGGGAAAAGAAGAATCTAGAGGTACTGAGGTC
CTTTCAGAACCAGATCGCTGCTATTCAGAGAGATGCTGTG
TGGTGGCTGCACTCTGTTGTTCCCACCATCAGTAAAGTGG
GACCCAAAGACTACGTGCACTGCCTCCACAAGGTGCTTTT
CACCGAGCAGCCTGAAACGTATTATAAATGGGACAACTGG
CCTCCTGAGAGTGACAGAAATTTCTTTCTTCGGCTGTGCT
CTGAGGTTCCTCTGCTGGAGGACACATTGATGCGCATCTT
GGTGATTGGTCTGTCCCGTGATCTGCCCCTGGGCCCAGCT
GATGCCATGGAGCTGGCTGATCACCTGGTGAAGAGAGCTG
CAGGAGTTCAGTCTGATGATTTGGAAGTGTTGCGGGTTGA
GAGGATCCAACTCATCGATGCTGTACTGAATCTTTGCACT
TACCACCATCCAGAGAACATCCAGCTTCCAGCAGGGTATC
AACCTCCAAATCTGGCCATATCAACTCTTTACTGGAAGGC
CTGGCTCCTGCTGCTTGTGGTGGCAGCGTTTAACCCACAG
AAAATCGGTTTGGCAGCGTGGGATGGTTACCCCACTCTGA
AAATGCTTATGGAGATGGTTATGACGAATAACTACTCATA
CCCTCCATGCACGGTGGCCGATGAAGAGACCAAAACTGAG
ATGATCAACCGTGAGCTGCAGATCTCTCAGAAGGAGAGGC
AGGAGATTCTGGCCTTTGAAAGTCATCTGGCAGCCGCCTC
CACCAAACAGACCATAACCGAGAACAACAGCCTTCTGCTG
TCTCAGCTCACCAGCCTGGACCCAAAGGGTCCCCCACGTC
GACCCCCACCTCTTGTCCTGGATCAAGTGAAGAGTTTGAA
TCAGTCTTTGCGTCTGGGTCATCTGCTCTGCCGCAGCCGC
AGCCCTGACTTCCTGCTCAATATCATCCAGAGACAGGCTT
CTTCTCAGTCTATGCCGTGGCTGGCTGATCTTGTCCAGTC
CAGCGAAGGCTCCTTAGATGTGCTGCCCGTTCAGTGCCTG
TGTGAATTTCTCCTCCATGATGCAGCAGATGATGCCTCTT
CTGCTGATGATGAAGAGGAAGGAGAAAGCAAAGAACAGAG
AGCAAAGAAAAGACAGCGGCAGCAAAAACAGAGGCAGCTT
CTTGGGCGGCTGCAGGACCTTCTGCTGGGGTCTAAGGCTG
ATAAACAGACCACATGTGAGGTCTTGGACTACTTCCTCCG
GCGTCTAAGCTCTTCTCAAGTGGCTTCAAGAGTGTTGGCC
ATAAAGGGATTGTCTCTGGTGCTGACGGAGGGCGGATTGA
AAGATGGAGAGGACAGGGATCATCTCATGGAGGAGGACTC
CAGAGATGCAGAGTTACTGCCAAGCTACCAGTGGCTCCTT
CAAGACCTTCCTAAACTGCCTCTGTTTGACAGCGTGAGAG
GCTTAACGGCCAGTGCTTTGCAGCAGGCCATTCACGTAGA
GACGGATCCTCAAACCATCAGTGCATACCTGATTTACCTT
TCCCAGCATGCACCAATAGAAGAGCAGTCCCTCCACAATG
ACCTAGCCTTGGATGTGGCCCGTCTTATAGTTGAACGCTC
CACTATAATGAACTGCTTGTTCTCCAAGCACTCCTGCAGA
CCCGAGTCTGATGCGGTTCTCTCCGCTCTGATCTCCATCT
TCTCCAACTACATCCGTCGCATGAGGAAGACAAAAGAGGG
AGAGGACCTTTACAGCTGGTCAGAGTCTCAGGATCAAGTG
TTCCTGCGATGGACCACTGGAGAAACAGCTACGATGCACA
TTCTGGTAGTCCATGCTATGGTCATCTTGCTCACACTTGG
ACCTCCCAAAGGGGAAAGCGAGTTCTACATACTCCTGGAT
ATCTGGTTTCCTGATAAAAAGCCTCTTCCTACTGCATTTT
TGGTGGACACTTCTGAGGAGGCTCTTCTGTTGCCTGATTG
GCTGAAATTGAGAATGATCCGATCTGAGGTCTCCCGCTTG
GTTGATGCAGCTCTGCAAGATCTGGAGCCCCAACAGCTAC
TGTTGTTTGTCCAGTCTTTCGGGATCCCCGTCTCCAGCAT
GAGCAAACTGCTGCAGTATCTGGACCAGGCCGTGTCTCAT
GATCCCCAAACACTGGAGCAAAACATCATGGACAAGAATT
ATATGGCTCATCTGGTGGAGGTCCAGCATGAGAGAGGAGC
CACAGGAGGACACACGTTCCACACTTTGCTCAGCGCTTCA
CTTCCTCAACGTAGAGACAGCTCAGAGGTGAGCAGGGCTA
AAGTGACTGTTGAAACACCCCATGGCTCTGTGAAGATGAG
AGCAGTGAGTCAGGTGCCAGTAATCGGCCCAGAGGATGAT
CTTGCTGGGGTCCTACTACAGCTCTTCCCTCTAAAGGTAG
ACCCCCACTGGCCTCAACCCCCCGTCCGGCCATTATCATT
AGCTCTGCAGCAGACTCTGGCTCAGGAGGTGCTGCGAGCA
CGCCAGGGTCACATCCAGCCGGGTGGAGCTGCTGGAAGAC
TCCTTCAAGCTTTAGCAGTCCTTCTTAACTCTGGCCACGC
TGGAGCCCTGGTCATGGCAATGCACCACAGCCACACTATC
TCCTGCCCTCTACTGCGCCAGCTGCATCTTTACCAGAGGT
CGGTTTCTCAGGACGTTGGCTTCTCGTCACTGTTCTTTAA
CGCCGTAGTGCAAATGTTGACGTGGTTGGAGAACTCGGCG
GTAGACACGGGTCCTCTCCACAGCCTCCTGAAGTCTCTGG
CAGCGCAGTACTCTCACAAACATCGCATCACAGATGTTCG
TACAGGATTTCTGCATTTGGCTGAAGCGCTAGCTTACAGA
CGGGACTCTGAAGTGGCAGTGAGGGGCATTATTGCTTCTC
TGAGAGCTGGAGAAAAGTGCAATGCTGAACCTGAACTCAT
CAGAAAAGTGTTGCAGGGCCTTATGGAGGTGAAGTCTCCA
TATCTGGAGGAGTTGCTGTCTCTGCTTATGAGCATCGGGA
CAGAGACCGGAAGCCCAGGAAGCACAGCGGGCCCCGTCGC
CATGGTTATCTCTCTCCTGCTTCAGGAAACAGAGGAGCGC
GGGGTGAAAGTAGAGCTGGATTCCAAAATCACTGAGTCAA
AGAAGCCTGGCTCATGTTCAGGGCTTTTGGTTGACTGGCT
GGAGTTGCTTGACCCTGAGGTGACCTCTGTATGCTCAGAT
CTTCAGCAGAAGCTGCTTTTTGCTCAAAACAAGGCTAAAA
GCAGTGGTGTGAGTGTGGCTCCTTCATACAGGCCATACCT
GCTGGCCCTCCTCACGCATCAGTCCAACTGGAGCACGTTA
CATCAATGCATCAGCTCTTTGCTCAACAAACACAGAGAGC
AGAGACTCGACCCGACCTCAGCTCTGGACTTCTTGTGGGC
CTGCAGTCACATTCCCCGCATCTGGCAGGGGCGAGATCAG
AAGACCCCTCAGAAGCGCACAGAGCAGTTTGTTTTAAAGC
TAAGCTCTGAGGAGCTCATCAGTCTGGTGGATCTCATCCT
GTCTGAGTCGGAGCTGAGCTGCCGGGACTCGGGCTCCTCC
AAGAGCGCTCTGGACCCGGTCTCCTGCTCTCTTCTCCAGT
CCCGACTGCCTCTCCTGCACAGCTGTCTGCACTCAGACCT
GGACAATGTCAAGAGGGTCTCCGAGTACCTCATCAGCTGC
GTGAAGAAGTGGGGAGATAGTATAATGAGTAAGAAGTGTC
AGACGCTGCTGCTTCAGATCTATCTGCACTTCCCGGAGGT
CATCCAACACATCCGCCTACCAGAGGCCACACTGAGCGGC
GAGGGGGCAGCAGACGGCAGCACATGCAAGTTGGACGTCC
TCGTGCATCGGCTCATCACTCTGCTGGCTGACACTGGAGA
CTCCAAATCAGCTGAAAACCGTGTGTCTGATGCCAATCTG
GCCTGCAGGAAACTGGCTGTCTCTCACCCGGTGCTCCTGC
TCAGACATCTGCCCATGATTGCTGCTCTCCTGCATGGTCG
CATCCATCTAAACCTTCAGGAGATCAGGCAGCAGAATCAC
CTGGGCTTCTTCACTGATGTTCTGGCTGTGTTGGAGCTCT
TGCAGCCGCTGGTTTTCAACTCTGACCACCAGAGAGCGCT
GCAGGACTGTCTACTGTCCTTCATCAAAGTACTGCAGAAC
TTCAGGAGATCATCCCGTCTGCCAATAATCAACAAATTTG
TGCAGTTCATCCAAAAATACATTACCCATGATGCCGCATC
AGCAGTCCCTTTCCTTCAGAAACACTCAGATGTGCTTCAG
GGTCTGTCTACGGAGAATCCAGACCTGGTGCAGCTGAAGT
CTCTGCTGGCCGGCTTGACTCTGCCGGTGAAGTGTGGCTC
TTCTGAGAGCTCGGCTGAGGATGGAGACGTGGAGGAGTCC
TCCTCAGGATCCCTACCGCTGGTCAACATCTCTGCCTCCA
TGTCTCTGACCGCTGCAGACATGACCAAATGCCTGAAGAA
GATCTCCAGAGGGGAAGCCATTGAAGATGTGTTTGAGGGC
CTGACTGAAGTGGATGAGAAATCCAAACGGAATCCAGAAA
TCATTCAGTATTTTGTCAACGATCTACAGAGATTGATGAG
CTCTCCTGAAGAGGTTTGCCGCAACATGGCATTCAGTTTG
GCCCTACGCTGCATCCAGAACAGCCCCAGTATAGCTGCTG
AATTCCTGCCAACCTTCATGTACTGTCTGGGCAGCGGGAG
TTTTGATGTAGTGCAAACGGCACTGAGAAGCCTGCCCGAA
TATGTGCTGCTCTGTCAAGAACATGCTGATATTCTCCTCC
ACAAGGCGTTTTTAGTGGGCATCTACGGTCAGATCGACAC
CAGCTCCATGATAGCAGAATCCATGAAGGTCTTGCGCATG
GAAGCGACTACTTAGTCGTCCTCTTTAAACACTTTTAACT
TCTGCAGTGCTGATCATGTCTCGATCTGTGTTCAAACACC
TGGCATCCAACTTTCTTGAATTAATTTTTTAGGAAAAGCT
TTTTAGTTTCCAGTGACATTCTGTCATATTGTCTACTGCT
TTGAATAAAACAATACGTCACACAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ints1-201 Contained in:
OTHER ints1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000049868 (1)
  • Ensembl_Trans:ENSDART00000163595 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EE331442 (1) 925bp
    GenBank:EE326435 (1) 867bp
    GenBank:CT666651 (1) 796bp
    GenBank:DN903239 (1) 628bp
    GenBank:CT642905 (1) 597bp
    GenBank:BE201309 (1) 521bp
    CITATIONS (2)