header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-131113-1776
Transcript Name: akt1s1-201
Previous Name: akt1s1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000049742 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000049742|OTTDARG00000035011|ZDB-GENE-030131-482 akt1s1|OTTDARP00000039020 akt1s1-001 LG_ BX005066.3 Danio rerio protein_coding KNOWN, 2379 bp
GTTTTTCAAAGCATTTGCGTGTTTCTCCTGCGCAATCTGG
CAACCCTGGTCCGTTCCTACTGTAAACAGCGCTGTGAGCG
TCGCTGCACTGGAGTCTAGGGGAGAGACAGGCACGGGCAG
AAAGCTCCGAATAAAGAGGGCGTAAAAGTTTGAAGAAAAG
GACGACTGTGGTAGAGGCGGGAGGATATTAAGAGAGTAAC
ATCAGCAAGTGGTGACGTCCTCCCATCTCTCCCCTAGCTC
TCTCATGCACGCATACACCATCACCCATTTCAAATGTGCC
TCTTCTAATAGTCCCATCAGCATTATCTAAACCAAGTTGT
CATTACCAAAGAGTGCTATCCTCAAAAACACATTTCATAA
GTGCATACATTCACATACGCCAGCATTTCAACATTCCAAA
AAACAGTTCAGCAGAGCCATATTTGATGCATAAACACATC
ATGGCCTCTGTCGCCAAATCCTTGAACCCCGAGATCCCTG
ATAATCACAAAGAGTGCTGGTTGGCGCTGCTTGCTGCCGC
AGAGGCGTACAGTCAGACGTCTGGATGTGATTTGGCTATT
CTGACTGCGTATAAAAAGTTCCATCCATCCGGGATTGAGG
TGGAAGGACAGAGGAATCATGAAGGAGGTGGGACGTCTGG
AAGCAAGAAGTTTGATTATGAATATCATGTATGGGGTCAA
GGGGCGTTGGCTGAGTCGTCACGGCGATACGTGGATGACA
TCGCCGTTCTGCACTCCACCACTGTATTGATGGCACAGAG
ACACACAAGGATGAATACAGATGAGGGCGGAGCCAAACTA
GGCGTGGACATGCCATCTGATAGACTGAGCTTGACTGGAG
ATGGAGTCGGTACTGTTAGTCCGAACATGAGGCTCTATTC
TCAGAGCTACCCGTCCATCTACAGTTCGGCTGCTGCTGCT
GCCATTGGCCTGTCAGTCGGTCAACATGGAAACGGAGAGC
GTGACAGAGAGAAAGCTGCAATGGAGGAAAGGGAGAGGGC
AAGAGAGGGAGCAGAAATAGTGGACTTGGAGGAAGAAGAT
GAAGATGATGAGGAAGAAGATTTGGATGGAAGGAGACGTA
ACCTGAATGAATCGGCAGGTGTCTTCTCAATGGATGAGGA
CTCTTTGTCCCGGGACTGCGAGCCCTTCTTTGAGTCTGAT
GGGGAGGAGGAGAGCACTGATGGTTCTCTGAGTGAGGAAG
CACCGCCGCCTCCTCGTGGTATGGCAATGGGTCACTTGGC
GTCCCGCTCCTCCAACCCCATGTCAATGGCTCGTTCATTG
CCTGTGTCAGTTCCGGTGTGGGGCTACAGGAACAATCATG
CCCCTCAGGGAGACTCGCACAGTGGAGAACGGGTGGGCTG
TGCAGACTTGGACCACATAGCTGCGAGTATGAAAGCCTTA
CTGGTCCCAGGAGCCACCGATGGGACGGAGATGTTCGGAG
CACTGCCTCGGCCTCGTCTAAACACGGGCGACTTCTCTCT
CAAACACTGAGAGGGTGATTGTGTGCATATGTATGAATGA
CAGACTGAGCGTGCATGAGAATGACAGGTGAGCTCGCTTG
TGTGCGTGAAAGAAGAGAGTTGACCAGAACCGGAGAGTTT
CAAAGAATGTTTTTTAGCAAAGACGTTGCCAAAATCTGAA
GCTTCTCCTGCATATCATTAATAGTATTTCTATGGCGTTT
CAAGTGGCTAAACCTTTTACCAAACCTTCACATCTGCAGC
AGCAGGAGGAGGAAGAGGAGTAGAGGTTTGATCAGCATGT
CTTAATCGGGACAATTTCTTCTGGTTGTGGCAGACCTTAG
TTACGTAGTGCATTTCACTGAGAAACACTAACAAACATCA
TTTCATTACTAATCATACGCAGTAACTGATAGATTTACTG
AAGGTAATTGAGCTGATATACACCACATCCGTCATCAGAG
AAGCGTTTTCCGTTAACAGACACTACATGTACTTGTATGT
ATAGACTGCTGAGTTCAGATGTGGATTCAGTAGTTTTTAC
TGTGAATGCTTACAAATGATGTCACTCTTTGGCTGCGTGA
AATATCGTTCATTTCAGAAAGAGTTTCAAAGAATTTCTAC
AATAAGCAGGACAATAAGCTTTTAAAACACCAATGTTATA
AATTATTCACCTGCAAATTACATTTTTCTGCATTCTTAGT
GATTTAATGTGCTGATAACGGATATAAATGCCGACGTGCG
AATTGTTGATTAGTTCGATGACTTCTCTGAAAAAGTTTTC
GCTAGATTGAAGGATATGTCAGGTTTGAGGGTTTTCAACA
CTACAGATGTCAACCAGCTATGTGTTTATCTTAATTATTT
CACGACTGTTCGATGTTGAAGTAAATGCGTTTTGAATAAA
CATGTTGTTTGTTGTTGAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
akt1s1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000049742 (1),  Ensembl_Trans:ENSDART00000157320 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CK029946 (1) 1118 bp
GenBank:CN022732 (1) 939 bp
GenBank:CT661137 (1) 882 bp
GenBank:CT609133 (1) 826 bp
GenBank:CA471788 (1) 810 bp
GenBank:DV591620 (1) 802 bp
GenBank:DV596499 (1) 787 bp
GenBank:CT602641 (1) 781 bp
GenBank:CT602849 (1) 702 bp
CITATIONS (2)