ZFIN ID: ZDB-TSCRIPT-131113-1722
Transcript Name: si:dkey-56f14.7-202
Previous Names: dkey-56f14.7-002, si:dkey-56f14.7-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048562 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048562|OTTDARG00000034335|ZDB-GENE-131121-78 si:dkey-56f14.7|OTTDARP00000038086 DKEY-56F14.7-002 LG_ CR848666.4 Danio rerio protein_coding NOVEL, 942 bp
AGAGCAGTCCCTTTCTTTCAGCAAGGAGTCAATGGGAAAT
ACTACATTGGGTTCTACTACTTCATTTCTCATATCCACAC
GCAGACTGGATCTTTTTTTTGAGAGAACTATTCTGGCTGT
AGGAGCATTTGCTGTCGCCTGCATTATTTCACATCATTGC
CACTGTGACCAGCCTACAGTATTGATGGTTCATTCCTTTC
CGCTGGCACACATGCAATTTTAGTATTAACACATGGACAT
GGCTGTGACATGTGGAGAAAAAACAGAAAAGGTACATCAC
ACAAAGTGTCACATCACGGTTTAACACAGCGGACAAAGAC
AGAGTTTACAGGCCAATGCCCAAGTCAGAGATGTTGAGCC
AGGATGACCCCAAATCACGCCCAATGCTAGAACTACGAGA
GAAGCTCCAGCCAGAAGTGATCGAGCTGATTAAACAGCAG
AGGCTGAACCGTCTGTGTGAGGGCACTTGTTTCAGGAAGA
TCAGCGCTCGTCGCAGACAAGACAAGTTCTGGTATTGCCG
TCTGTCACCAAACCACAAAGTGTTACACTATGGAGATATA
GAAGAGTTCTCTCAAGGACAAATATCACATGACTCTCTCC
AGGACAAAGTGACAGTAGCAGATATCAAAGCAGTGGTAAC
AGGTAAAGACTGCCCACATATGAGGGAGAAAGGAGCACTT
AAGAATAAGGAGTTGCTGGAACTGGCCTTTTCCATTCTTC
ATAACTCTGATGAATATTTAAACTTCATCGCTCCAGACAA
GCACGAATACTGTATATGGACTGATGGTTTAAATGCTCTT
TTGGGAAAAGAGATGACAACTGAGCTCACAAGATCAGATA
TGGACACACTGGTTACTATGGAGCTGAAACTTCGCCTTTT
GGACCTCGAAAACATTCAGATTCCTGATGTCGCTCCTCCT
GTTCCCAAAGAGCCCAGCACTT

si:dkey-56f14.7 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:dkey-56f14.7-201 (1)    Ensembl 1530
si:dkey-56f14.7-202 942
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-56f14.7-202 Contained in:
[BAC] DKEY-56F14 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000048562 (1),  Ensembl_Trans:ENSDART00000157237 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH435281 (1) 974 nt
GenBank:EH592131 (1) 969 nt
GenBank:CN510839 (1) 932 nt
GenBank:DV590150 (1) 765 nt
CITATIONS (2)