ZFIN ID: ZDB-TSCRIPT-131113-127
Transcript Name: si:dkey-56f14.7-201
Previous Names: dkey-56f14.7-001, si:dkey-56f14.7-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000048561 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000048561|OTTDARG00000034335|ZDB-GENE-131121-78 si:dkey-56f14.7|OTTDARP00000038085 DKEY-56F14.7-001 LG_ CR848666.4 Danio rerio protein_coding NOVEL, 1530 bp
CAAAGTGCTGTGTTGCAGCACTGTAACAAGTAAAGAAAAG
TAGTTCCCAGAGGCTCAGGAGGTTTCTGAACATTAAACAT
ACAGACACTGTAAAAATTTGTCTGAAACTGTATGGCAGAT
ACATCACAGCATATTGTAAATTGATTAATAAATGGAGCTT
CCAGCAAACAGAGGAATCATTCTCTGCTTATGAGGAACAT
TTACATAAGTTGTGGTTGGCTTTTTTTATTATTACTTTAG
TGTCTTCCCCCCACATGATCAATGGTGAACCTACAGTACT
GCTAAACAGATTTTGTGTTCCACAGAATGAAGTCAGTCAA
ATGTACTCAGAACAACATGAGGGTGGAGAAAAAACAGAAA
AGGTACATCACACAAAGTGTCACATCACGGTTTAACACAG
CGGACAAAGACAGAGTTTACAGGCCAATGCCCAAGTCAGA
GATGTTGAGCCAGGATGACCCCAAATCACGCCCAATGCTA
GAACTACGAGAGAAGCTCCAGCCAGAAGTGATCGAGCTGA
TTAAACAGCAGAGGCTGAACCGTCTGTGTGAGGGCACTTG
TTTCAGGAAGATCAGCGCTCGTCGCAGACAAGACAAGTTC
TGGTATTGCCGTCTGTCACCAAACCACAAAGTGTTACACT
ATGGAGATATAGAAGAGTTCTCTCAAGGACAAATATCACA
TGACTCTCTCCAGGACAAAGTGACAGTAGCAGATATCAAA
GCAGTGGTAACAGGTAAAGACTGCCCACATATGAGGGAGA
AAGGAGCACTTAAGAATAAGGAGTTGCTGGAACTGGCCTT
TTCCATTCTTCATAACTCTGATGAATATTTAAACTTCATC
GCTCCAGACAAGCACGAATACTGTATATGGACTGATGGTT
TAAATGCTCTTTTGGGAAAAGAGATGACAACTGAGCTCAC
AAGATCAGATATGGACACACTGGTTACTATGGAGCTGAAA
CTTCGCCTTTTGGACCTCGAAAACATTCAGATTCCTGATG
TCGCTCCTCCTGTTCCCAAAGAGCCCAGCACTTACAATTT
TGTTTACGACTTTACCCAGCAGCACAATTGAGACTGGAAA
TGTCCATCATCAGCTGCAAGGATGTATTCACCTTCTTCTC
TTTTATTCTATTATACGTCTATCCCTATTATATGGACGGA
ATCATTTTTTTCTCCTCTAGATTGTGACTATGATGTGATG
CTTTAGTTTTATATTCCCTGTAAATTACTGCTATGACTTC
ACTGAGGAAAACGACAGTGATATTTCTTTTTAGTCACCTG
TTATAACAAATACTCAACTTGCTATCATGCACAACATTTT
GTGTAACTATGTGTACATGAAAAAAAAAGTGAAACTGCAT
TTGTTTCATACTCATACATAAAACACCACACATAACTCAT
TCTTGGACTGTTACAAATGTGCTAGTAATTTGATAAAAAG
ATAAACTAAATCATCCTGAAAAATAAAGTGACAGTTAATT
ATAGAGACTACTTTCTGCCATTGAATAAAAAAAAAAAATC
AAAAAGGTAA

si:dkey-56f14.7 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:dkey-56f14.7-201 1530
si:dkey-56f14.7-202 (1)    Ensembl 942
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-56f14.7-201 Contained in:
[BAC] DKEY-56F14 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000048561 (1),  Ensembl_Trans:ENSDART00000153591 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CN018932 (1) 955 nt
GenBank:EV757482 (1) 947 nt
GenBank:DV592504 (1) 801 nt
GenBank:EH609634 (1) 763 nt
CITATIONS (2)