ZFIN ID: ZDB-TSCRIPT-131113-1705
Transcript Name: nek10-201
Previous Names: nek10-001, ch211-231m23.2-001, si:ch211-231m23.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047800 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047800|OTTDARG00000033901|ZDB-GENE-130530-570 nek10|OTTDARP00000037524 CH211-231M23.2-001 LG_ CU855686.17 Danio rerio protein_coding PUTATIVE, 2943 bp
AATGCTTGACGACCTTCAGCAATGCGAGTAAAAAACACGG
AACATTCCAGAACCACACAGAAATGAGAGTAATGAAGGTT
GTTTCAAGATGCCTCTCCAAGACAGAAAGTCTAGAGGACC
GAACAGATCACATCAGAAAACTAAAGACAAGGAGCTTCTT
GATCTCAAGAGACTTTTATCAATGATCACAGCTCCAATAT
CCAAACAGGCTTCATCTCTGAGTCAATCAAAAGGACACAA
GTCTCAAACTTCCACAAATGTTCCTGAGCACCGGAAAAAT
GCCACTGAAGCGTCTGAGCTGGAAAACTTTAGCGTGACAT
ACAGAAAGCAGAGATATTTCAATGACCAGCCACATCACAG
ATTATTCCTGGACATCTTCACTGCCTTGATCAATAACAGG
CTTGGTTGTAGCGACTGGCTGGAAAATTCCTCTTCAGATA
ATGTTTTAAGAGTTCTGAACTGCCTGAGATTGCTGATCAG
GGATCCTCTTCACCAGTCACATGTGGAAATTCACTGTGCT
TTATCGAATGTTTTTCAGCACATGGAGTCGGTTGCATCTG
TGTATCTCGAATGCGGAGAACAGACGCTGGAAATCGAGCA
GCTGGTAGCAATGACATATATCTTTCAGAAGTTGTCTACT
GTTGAGGAGCAAAGACAGTGGATTATTAATTGTGAAGCAC
ATAAGACGCTCGTGAAGCTGCTCTCAACCCGGGACTGCAG
TGTTGTATTAGGAGCTCTTCTGGCTCTAACCACACTTGCT
GAAAGTCAAGAATGCAAAGAGAAGATCGGCGAGCTTTCAG
TTGTGGAGCATCTTCTAGATGTTTTGCAAGATTATGACAT
GTTATCGAAAAGGCTGAGCGCGGAGCTGCTGAGGTTGCTT
TGCTCGGTGCAGTGTGTGCGGGATCAGCTGCGTCAGTGTG
ATGGTGTGCCGGTTCTGCTCAGTCTCCTGCACTCAGAGCA
CATCAAGCTGCTGTGGAGCACTGTTTGGGTTCTCGTTCAG
CTCTGTCAGGATCCCGACACCAGCGCTGAGGTCCGGGCCT
GGGGCGGCGTGCAGCAACTACTGCGCATCTTACATGGAGA
ACGAGTGTATGTGTCCGATCGCTCCACCATTGATTCAATT
TCCAGCGCCAATGCAGCAGGCAGAATCCACAGTCAGCAGG
TGTCAGCAGTGGTGTGCGCTCATGAAACAGCGGAGAACAC
CATCAGTCTGCAGTCAGCATGCTGTGCAGCGATAACCGAG
CTTGTATTGGATGATACGACAGCGCATAATGTGGTGCAGG
AGAACGGTGTGTATATTATTGCCAAATTGATTTTGCCACA
GAATGGTAAAGAACCTCAAGCAAAATCTCTACAGTGTTAT
GCTTTCAGAGCACTGCGATTCCTCTTTAGTATGGAACGCA
ACAGACATCACTTTAAAAGGCTGTTTTCTCCAGATTTGTT
TGAGATGTTTATCGATGTCGGTCACTACGTTCGAGACATT
ACTGCATATGAACCGCTGCAACAGAAAATCATGCTTTTAT
CTCCAGAAGAGTTGGATATTCTTAGGGAAAGCATCGAGAC
AGTAAACCAGAACCGTCCTCCTATAAGAGTGGTCAATGGT
TATGCGGTTTTGGAGCATCTAGGAAGCGGAGCTTTTGGCA
GCGTCTTTAAGGTTCGTAAGCAGAACGGACAGAACATTCT
GGCACTTAAAGAGGTCAACTTTCACAATCCGGCCTTTGGC
AAAGATAAGCGATCCAGAGACAGCAGTGTTGAGAAGATTG
TGTCTGAAATGACCATCATTAAAGAACAGATGTCTCATCC
GAACATTGTAAAATACTTCAAAACATTTTTAGAAGGTGAT
AAACTCTACATTGTAATGGAGCTCATTGAAGGAGCTCCTC
TGGCTGAGCATTTCAGCTCTCTGAAAGAGAAAAAGCAGAC
GTTCACCGAGGAGAGAGTCTGGAACATCTTCATACAGATC
TGTTTGGCTTTGAGATACTTGCACAAGGAGAAGCGGATCA
TCCACAGAGATCTCACACCCAATAATATCATGCTCGGAGA
GAGAGATAAAGTCACCATTACTGACTTTGGTCTTGCTAAA
CAGAAACAAGAGAACAGTAAGCTGACATCAGTGGTGGGGA
CGATACTGTACTGCTGCCCAGAGATTGTGAAGAACGAGCC
GTACGGTGAGAAGGCAGATGTTTGGGCCGCCGGCTGTATC
CTCTATCAGACGGTCACTCTCAATCCTCCGTTCTACAGCG
CTAACATGCTCTCGCTCGCTACTAAGATTGTGGAAGCTGT
TTATGAGCCACTAGAAGACAAAACCTTCTCCGAAAGAGTA
ACCGACATGATTAAATGGTGTTTGACTCCAAATGCAGACG
TCCGTCCAGACATCATCGAGGTCAGTTCCAGAATCTCTGA
TATCATGATGAGGTTTGTGGATAGTCTCTGTGTATCCCAT
AATGCACTGGAGAGAAGGGCGGAGCGAGACAGGAAGAGAG
CGCAGAAGTACTTTCTGGAGAGCAACAGGACTAGAATGTG
TGGCCCGATACAACAGCTCCCTCCAGCACCACAAAACAGC
TTCAAGCAGCGGGCAATTGAACGCTTTAAGAAGTCGCTCT
TCATATATGGAAGTGATGCATACAATCTCAAAGTGGAGCT
CAATAAGGTTCTTCAAGGCAGTCAGGAGCTGGTAGAGATG
TCTTCAGCCAGCAGAGAGTGGTGGTCCATGATTCAGTCTC
TAAGCTCAGACCCCTCAAACGCAGAAAATCGGGAATCAGG
TTACTCCAGTCTTCAAGACGGCCTCACATATGAAGATATA
CAGAGTATGGTGGAGGATGTGCTGGAGGAGAACGGATATT
ACAGCAGAAGAGATCTGGATTCAGGAGCAGCAACAAGACA
AACTCAAACTCCCTGATCGATCGACCGTCAGTGATTGATT
GATTGACAGCTGTCATGTCTGGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nek10-201 Contained in:
[BAC] CH211-231M23 (1)

Genome Resources: Vega_Trans:OTTDART00000047800 (1),  Ensembl_Trans:ENSDART00000155162 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EB926119 (1) 196 nt
CITATIONS (2)