ZFIN ID: ZDB-TSCRIPT-131113-1522
Transcript Name: si:ch211-69l10.2-002
Previous Name: ch211-69l10.2-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: lincRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000059859 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000059859|OTTDARG00000031858|ZDB-GENE-091204-42 si:ch211-69l10.2|no_translation CH211-69L10.2-002 LG_none CT573344.8,BX248091.12 Danio rerio lincRNA NOVEL, 631 bp
GGGCTCGAGACGAAGTATCCAAAGAATAACTCCACACCTG
AAAGGGAATATCTGCAGAAACCGAATCAATTCTGGAACAA
AAGAGGACCTTCAGAACAGCTGCCGGCCTGCCTGTCGTTC
TCTTGCTGGAAGCCTGAAACCAGAGCTAGGGGTGAATGCC
AAACTTTTCAGGAAAAGACCTCCACATTCTGGCCCCCCGT
GAGCTGACAGCTCTTTGCCATCAAAGTCAACAATACTGCT
TTGCTGCAAGGAGATGAAGATCGGCTGTTGACTGCGGACA
GCTGGGTTTCACACAATGGCATAAAGATGCGGAAAAGGAG
TCTGCATCCTCCGAAAGATGCGGACTTCAACGGTGAGTCC
TTCGAAGTCCACACAGGCTGAACGGAGCGTTTTCTACCCA
AGAGAGGACAGATTTCAGCACCAAGCAACCATAACAGCTG
CTGATAATAAGCGGAAATAAAAATTGTAATGCATTTTTTT
TTCAAAGTGATTTTAAAACTTATTTTCAGCGATCTTAAGG
CAAAGCAAATTTCCTTTGATCCATGAATTTACACATAAAA
ATGTAAACTGTCGACTCTTTTTGTAATTTAACATGTGTTA
TTGGAAGGGGAATAAACTTAATTTATACATT

si:ch211-69l10.2 TRANSCRIPTS
Type Name Length (bp) Analysis
lincRNA si:ch211-69l10.2-001 (1) 780
si:ch211-69l10.2-002 631
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-69l10.2-002 Contained in:
OTHER si:ch211-69l10.2-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000059859 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (1)