ZFIN ID: ZDB-TSCRIPT-091110-481
Transcript Name: si:ch211-69l10.2-001
Previous Names: ch211-124o16.3-003, ch211-69l10.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: lincRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000044378 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000044378|OTTDARG00000031858|ZDB-GENE-091204-42 si:ch211-69l10.2|no_translation CH211-69L10.2-001 LG_none CT573344.8,BX248091.12 Danio rerio lincRNA NOVEL, 780 bp
GGGCTCGAGACGAAGTATCCAAAGAATAACTCCACACCTG
AAAGGGAATATCTGCAGAAACCGAATCAATTCTGGAACAA
AAGAGGACCTTCAGAACAGCTGCCGGCCTGCCTGTCGTTC
TCTTGCTGGAAGCCTGAAACCAGAGCTAGGGGTGAATGCC
AAACTTTTCAGGAAAAGACCTCCACATTCTGGCCCCCCGT
GAGCTGACAGCTCTTTGCCATCAAAGTCAACAATACTGCT
TTGCTGCAAGGAGATGAAGATCGGCTGTTGACTGCGGACA
GCTGGGTTTCACACAATGGCATAAAGATGCGGAAAAGGGT
AAGGAATGCTGTGGTATTTGGAGTCGGACAGAAACCGGTA
TATAGGCAGCATATTTGTATATGTATTATAAACTTCAGCT
TATACTGGCGTTTTTGCATTATTTGTAATTGTTTATTAGT
AATTTTAGCCCATAATAACCTATTTCTCCTTATTGGAAAG
TTATGAGGCATATAATACAGACCGAATGGACCACATATAA
CACGTTTCGGCAGTTGTTTTTGAAATGCAGCCCCTCTTTG
TGAAAGATCTGTAATGTTATTAGGGATGTAACAATTCAAC
TGACTTTCGATTCGATAGGATTCACGATACTAATCTCACG
ATTTATTCACAATCATTTTTAACACAATTATTTTTAAATA
AAATGTTTTAAAACTCATTTAAGATGAAAAGCCCTCGATT
TTTTTTCTTAACTGCTGCACATTTTTTGTTAAATAATATT
TTCTGCCACAACCAAATTGC

si:ch211-69l10.2 TRANSCRIPTS
Type Name Length (nt) Analysis
lincRNA si:ch211-69l10.2-001 780
si:ch211-69l10.2-002 (1) 631
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:ch211-69l10.2-001 Contained in:

Genome Resources: Vega_Trans:OTTDART00000044378 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CT698648 (1) 782 nt
CITATIONS (1)