ZFIN ID: ZDB-TSCRIPT-131113-1372
Transcript Name: ottdart00000059182
Previous Name: dkey-223d7.7-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: antisense
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000059182 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000059182|OTTDARG00000041029|ZDB-GENE-040711-2 nceh1a|no_translation DKEY-223D7.7-001 LG_ CR786576.5 Danio rerio antisense NOVEL, 1661 bp
CGTCTGTGTTTTATAAAGCGATAGTTGCGTGAAGATGTAG
GCCACGGCGTACACGCAGTTTTATTAACCTCGGTTTTTGT
TTTCAGCGTTCTGGCGTCGTGCGCTATTAGCTACTGTAAC
TTATGTTTCTACTCAAATTAAACGAAACTCTTGGAAACTA
ACATTGTTTACCTGCAAACATTTAACGGAAAACATGTGAG
GAGGGATGTTCAGTCGACATTGATGTTCCTCAGAAAATTT
ACCATCAAGGTCTATTGCAAATTCTTACCAAATATTGCCT
TCCACACCATCGTCCTGTCGACAAATGAGGTCTACAAATG
TTTGTCAAGCCAAGCGATATAATTCTGCACTGCATTCACT
CCCACAGAGAAGTAGCAGGGCCAGAAAGCAAAGCTTACAC
AGCCATGAAATCCATCTTGATAATGGTCATTAGTGACAGA
GACGCCTGCCAGCTCCAACCTGCGGGCGTACATCATCCCA
TCATCCCTCAAAACATCATGCTCACCAGTCATAATATAAG
CACGTGGCGCCATACGCAAAACCTCATCCTCCGCAAGTAA
CGGAGAGGCTCTGGAATCCAGTAAACCTGGAACATCACTT
AAGATATTGGGAGATCCAGTCACTGGAAAAACAGGTTTAA
AATGTTTTCTTATTTCTTTTGGTAGAAGATTGGTCCAGTC
CAGCTTTGCACGATTCTGGGACAACAGATTTTGGTCTTGG
GCTGTGTGGTTGTTCATCATAATAGAGTGTGCAAGTTCAG
GGTCAGCGCCCAGGTACTCCAACCAGAAACGAGCCATTAG
TCTGCGGTATAGGATGGGGACATTATGGTTCTGCTGATAG
GAAGCTGTGTTGAAGTCGAGTGCCTGAAGGACTGGGTAAA
TCAACACCTGCAGCTTGAATTTTGCTGAGAGAATCATCAC
TTGCGTGTGCAACAAACCAGAGGTATGACAACAGAGGAAG
TACCATTTTTTAAAAAGAGGTGCTCCCGGCAACCCGAGTT
CGATTCTTGGCTTGAGGTTCCTTGCCATTTCTTGTTCCTC
TCTCCCTGCTCCCAGTGCATTCATATCTTCAGTCTCCACT
GTCCTCTCAATTAAAGGTGAAAAACCACATGGCGAGCAAG
AACAGAATCAGCTGTATGTCCTACATGTTGTTTACAGGGC
TGTTTGCATGTTATGGTATGCTTATTAATCACAATTTCAG
CAGTACTCTACGCCTACCACAAGGGTGCTGCTGGCAGTGG
AAACACATGTCTGATCAGAATGATACCATATTGCACTGCA
CTGAACCATACTGTTCAGTGAAAAGGCATTAAACACACCG
CCACTGGACGTGTTGTCTGGACTGACAAATCTTGCTTATC
TGTCTTGCAATTTGATGGACGAGGCTGAGTTTGCTGGTTC
CCAGGAGAACGATTATTGCTTGCCTGCCAAATGTAAGGTT
TGATGGAGGGGATTATGGTGTGGGGCTGTATTTTATGGGA
TCCTTAGTTCCAGTGAAAGAAACTTTTAATGCTTCATCAT
ACCAAGACATTCTGGCTAACTTATGACCATTATAAAGTGT
TTTATCAGATGCTAAAGAGAAGCATCCAATATTGGGAAAT
TTACGTGTGAATGAAACCACGATCAACCTTGAATAACAAT
GAATTATTTGTAGTGTTGGTC

nceh1a TRANSCRIPTS
Type Name Length (nt) Analysis
antisense ottdart00000059182 1661
mRNA nceh1a-201 (1)    Ensembl 1872
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ottdart00000059182 Contained in:
[BAC] DKEY-223D7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000059182 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (1)