ZFIN ID: ZDB-TSCRIPT-090929-10027
Transcript Name: nceh1a-201
Previous Names: nceh1a-001, zgc:92416-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000027473 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000027473|OTTDARG00000021563|ZDB-GENE-040711-2 nceh1a|OTTDARP00000022502 nceh1a-001 LG_ CR786576.5 Danio rerio protein_coding KNOWN, 1872 bp
CCCTGACAGCTGCAGAGAGACCAGGGAGGAGAGGCATCAC
TTCATGATGAAGCTGCTTTGCGGTTTTACTCTGTTGTTAA
CAGTTGCTCTTGCCTATTACGTCTACATCCCATTGCCCAG
GACAATCTCTGAGCCATGGAAACTGATGGTGCTGGATGCC
ACATTCAGGGGAGTTGTGAAGATGGGAGACATCGCTCACT
CACTGGGTTTAAGTCATAGCGTCCATGTTATCAACTCTGC
TATAGTTGGCTTTGAGAGTTTGGTGCCAATCACAAACCAG
GAGATCCAGACTGAAGATGTCCTATTTGATGGAGTCCACG
TGCGTGTGTATTATCCTCAGGGAGAGGAAGAAAAGCTGAG
GAGAGCTGTCATGTTCATTCATGGAGGTGGATGGTCCTTG
GGTGCTCCAAAGTTGGGGTCATATGACAGTCTCTGCAGGC
AGATGTCAGCTGATCTGAATGCAGTAGTAGTGACGGTGGA
CTATCGGATGGCTCCTGATGTGCACTTTCCGGTGCAGTAT
GAGGAGTGTGTGCAGGCAGCTAAACACCTCCTGAAGCCAG
AGGTGCTGAAGCAGTACTCAGTGGATCCTGAGCGAGTGGC
CGTCTGCGGAGACAGTGCTGGAGGAAACCTGGCCGCTGCA
GTGGCTCAGAGGATTGGAACAGAAAACAGTACCTCAGCAA
AATTCAAGCTGCAGGTGTTGATTTACCCAGTCCTTCAGGC
ACTCGACTTCAACACAGCTTCCTATCAGCAGAACCATAAT
GTCCCCATCCTATACCGCAGACTAATGGCTCGTTTCTGGT
TGGAGTACCTGGGCGCTGACCCTGAACTTGCACACTCTAT
TATGATGAACAACCACACAGCCCAAGACCAAAATCTGTTG
TCCCAGAATCGTGCAAAGCTGGACTGGACCAATCTTCTAC
CAAAAGAAATAAGAAAACATTTTAAACCTGTTTTTCCAGT
GACTGGATCTCCCAATATCTTAAGTGATGTTCCAGGTTTA
CTGGATTCCAGAGCCTCTCCGTTACTTGCGGAGGATGAGG
TTTTGCGTATGGCGCCACGTGCTTATATTATGACTGGTGA
GCATGATGTTTTGAGGGATGATGGGATGATGTACGCCCGC
AGGTTGGAGCTGGCAGGCGTCTCTGTCACTAATGACCATT
ATCAAGATGGATTTCATGGCTGTGTAAGCTTTGCTTTCTG
GCCCTGCTACTTCTCTGTGGGAGTGAATGCAGTGCAGAAT
TATATCGCTTGGCTTGACAAACATTTGTAGACCTATAGGA
AGAGACGAATACTTTAAAATGTGCATATTAGGGATTTACA
CATTGTGATGAATTCTTTCGCAACATGACATGATTTGTAA
CATTTAGTTAAGAATTAAGTATCTGATGTTTTACTGTATT
AAAAGAAACTGCATTGTCATTTCCAAATACTAACACATTT
CTGTTTTTTTAACTAAGGTACTAAAAACCAAATGACAAGA
ATTTTGTTTTAAATAATACTCTCTTTCTAACACCATTAAT
ATACACAAATATGTGCACACACCCTTTACGGTAAGCAGAA
TGTTTTTGAAAGTGTTTAAATTCAAATGATGGCTTAATTG
CTTTTGTGCTTGTCATTACTATCACCTAACATGTTAACAA
ATCATGTCATTTGTAACCATGCATTTCATAAACCTTTGTA
ACACTTTCACTCCAGACTTGATTTTACCATATGTCTATTG
CAAAACACTGTGAATAAAGCAGGAATTTATTAATGCTTCA
GTGATAAAAATAAAATTAAATATTGTCTAGTTTTATCAAA
TATTTTATAGCTATATATATATATATATATTATTTAGAGC
TTATAGCTCTACCAAATAAACAATGCAACAAA

nceh1a TRANSCRIPTS
Type Name Length (nt) Analysis
antisense ottdart00000059182 (1) 1661
mRNA nceh1a-201 1872
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nceh1a-201 Contained in:
[BAC] DKEY-223D7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000027473 (1),  Ensembl_Trans:ENSDART00000134543 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC074087 (1) 1885 nt
GenBank:DT872948 (1) 778 nt
CITATIONS (2)