Transcript

cyp2y3-202

ID
ZDB-TSCRIPT-131113-1301
Name
cyp2y3-202
Previous Names
  • si:zfos-411a11.2-001
  • zfos-411a11.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057949 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057949|OTTDARG00000040389|ZDB-GENE-131119-33 si:zfos-411a11.2|OTTDARP00000045381 ZFOS-411A11.2-001 LG_ CU928854.3 Danio rerio protein_coding NOVEL, 1596 bp
CTGATCGGTAAGAGGAATGGAGCTCTCAAGCTCACTGCTG
CTGGTTTTGGTCTTGACTGTGTTGATGTTGATCAGATGGA
GGAGGAAGGAGAACGGACTTTCTTTGCCCCCGGGGCCACT
GGCACTGCCACTGATCGGAAACTTACTAACAGTGGAAACA
AGTGCACCATTTAAGAGCTTTATGAAGTGGAGCAAATCCT
ATGGGCCGGTGATGACGGTGCACATCGGGACTCAGAGAAT
GGTGGTTCTGGTGGGTTATGAAACAGTAAAAGAGGCTCTG
GTGGACCAGGCTGAAGACTTTGCATCCAGAGCTCCCATTC
CTTTTACCAACAGAGTTCTAAGAGGCTATGGTCTGATCAT
CAGCAATGGTGAACGCTGGCGTCAACTGAGGCGGTTCACG
CTCACCACACTGAGGGATTTTGGAATGGGACGCAAACGAA
TGGAGCAGTGGATTCAAGAAGAGAGCAGATACTTGCTCAA
GAGTTTTGAAGAAACCAAATCCAAACCAGTTGATCCATTA
TTCTTCATGAGCCGGGCTGTGTCCAACGTCATCTGCTCCC
TGGTGTTTGGGCAGCGCTTTGATTATGAAGACAAAAACTT
CTTGCAGTTGCTCCAGATCATCTCTAACCTCATGCGATTT
GCAAGCAGCCCTTGGGGACAGCTCTACAACATCTTCCCTA
AAGTCATGGAGATCTTACCAGGTAGACATCATACCATGTT
TGGAGAGATTGATGATCTCAAATCCTCCATAATGACAATT
ATCAAGGAGCATGAGGAGAATTTGGATCCCAGTGACCCAA
AGGACTTTATTGACTGCTTTCTTATCAGGCTCAATCAGGA
GAAACATAATCCTGATACAGAATTCCACAAGGAAAACATG
TTTGCCACCTCTTTAAATCTGTTTACAGCTGGTACAGAGA
CCACCAGCACAACTTTAAGATACGCTCTAATGCTCCTGAT
CAAGCACCCTCACATTCAGGAGCAAATGCAGAAGGAAATA
GATTGCGTTATTGGACAGAACAGAATTCCAACAATGGAGG
ACAGAAAGTCTCTTCCCTTCACTGATGCTGTGATTCATGA
AGTGCAGCGCTGTCTGGACATTGCACCACTGAACGTTCCC
CATTATGCCCTGAAAGACATCACTTTCAGAGGCTATAAAA
TCCCCAAGGACACAGTAATTATTCCCATGCTGCACTCTGT
CCTAAGGGATGAGGGACATTGGGAAACCCCTTGGACATTT
AACCCAGAGCACTTTCTGGACTCCAATGGCAACTTTAAGA
AGAATCCAGCCTTTATGCCCTTTTCTGCAGGTAAACGTGT
GTGTGTCGGTGAGTCTCTGGCTCGTATGGAGATCTTTCTG
TTTATCGTGTCTCTGCTTCAGAAGTTCAGCTTCAGTAGTC
CTAATGGTCCAGACAGTATAGACCCCAGTCCTGAACTCAG
CAGCTTTGGCAACATGCCTCGACTCTATGAACTCATAGCA
TCCCCTCGCTGAGCAATGTGGAGATTGTAACATATTACAT
GAATGCAGTCATACAATACACAGAGAGAGTGACCACATGT
TGCTGAAATGCACTTTAGAATGTAAGAGGTGGTTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations