Transcript

a2ml-201

ID
ZDB-TSCRIPT-131113-1175
Name
a2ml-201
Previous Names
  • a2ml-001
  • am2l-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057312 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057312|OTTDARG00000039947|ZDB-GENE-090212-1 a2ml|OTTDARP00000044919 am2l-001 LG_ CR626907.15 Danio rerio protein_coding KNOWN, 4537 bp
CTGGACACTCGTCATCATGGCTCTGAATGTTAGCTGTTGT
TGGAAAGGGCTCCTCCTGAACTTTTTCCTTTTCGTCTGTG
TCAATGGACAAGCAGCAGAGCCATCTTTCATGGTGACTTT
TCCTGCCGTGATTGAGTCAGGATCTGAGGCCAAACTGTGT
GCAAGTCTTCTGAAGCCCAATGAAAGTCTCGTCATGAACA
TATATCTGGTTCATGGGAACCAGAGCACATTACTGCTGCA
GGAGAATGCTGAGCAAGAGTTTCACCGCTGCTTTAACTTC
AAGGCCCCTCTAGCAGAAGCAGAATCAGTGCAGAAAATCA
AGGTTGAACTTCAGGGAGAGTCCTTCAAGATGACTGAGGA
AAGAAAAGTCATGTTCAAATCTTACGATCCTCTGACCTTT
ATCCAGACTGATAAACCCATCTATATGCCTGGACAGATTG
TGAACTTCAGAGTTGTTACCATGGATACAAACTTTGCACC
TGTTGATCAGCAGTACAGTATTATCGTGCTTGAGGACAGT
CAAGATAACAGGATTGGTCAATGGACAAATGTTTCCTCAA
CAAGGTGGATTTTGCAGCGCTCATATGAATTAAACCCAGA
ATGTCGTGAAGGCGCATACAAACTAAAGGCTTTTATTGGA
GAAAGGATGAGCTCACATTATTTTCAGGTGAAAAAATACG
TTTTGCCTAAGTTTGAAGTTACAGTAAAAAAACCAAAGAC
AGTGAGTGTTGTTGAGGAGGAACTGTTAATTGAGGTTTGC
GCAAAATACACTTATGGACAACCTGTGCCTGGTAAATCAT
GGGTAAAAGTGTGCCGTAATCCTTTGCCCTACATTATTTT
CTTTCCATTGTGTTTAGAGGAAACCCTTGAGATAACAAAG
ACTGGCTGTGCCATCCATAACTTCGGTTTATCAATGATAT
TGAACTCCACACTAAAAGATAACTTAAAGGATTCTCTTCA
TGTTGAGGCAGTGGTTACAGAAGAAGGAACGGAGATCACC
ATGACAAAATCTGAATCTGTACATCTCACGTATGAAATTG
GCAAAATCACACTGATTGACCTGCCCAAAACATATGAACC
TGGATCAGTCATAGAAGGAAAAATCAAACTTTCCGATTTT
AAGGATGCTCCAATTCCAAACAAAGAGGTTTATCTTTTAG
AAGGTGAAAACTGGTCCTCCAAACTGCTCCTAAATCTCAC
TACAGACAGTGATGGACTGGCCAGCTTCTCTCTTAATACA
TCTAGTCTTTCTAAAAAAGACATTTCTCTGATTGCAAATG
TGTATCCAGATACCCGTTATTATGGCTACAAAACACCTTA
CTTCTCTACAGATAAAAAAACTGTTCAGCTCTTCCGGATC
GCCACTGTGTACTCCCCAACATTAAGTGAACTGATTATAG
AAGATATTGAGCAGCCATTAAAGTGTGGCACTGAGATTAC
AGCCACTGTCAAGTATTATTTTGTTGGCGAGACTGTTGAA
GACTTCAGTACTGACATTGTCTATATGGTCTTGTCCAGAG
GAGTGATTGTTCATCATGGATTTGAGAAGGTTGAAGTGAA
GTCTTCTTCTAATGGATTAGCAAGTGGCACAATGTCCTTC
AAACTGTCTGTTGGTGCAGATGTGGCTCCTGTAGTGCAGA
TTCTGGCATACTGTGTTCTGCCCAGTGAAAACGTTATTGC
TGCTAACAAAAGATTAGACACTGAAAAATGTTTTGGTAAT
AAGGTGTCTCTGCAGTTTTCTCCTGCTAAAGCAGTTCCTG
GTGAGAAAAACACTCTCCAGCTCTCAGCTCAGCCTGGTTC
ACTGTGTGGCCTCAGTGCTGTAGATCAGAGCGTCCTGATC
CTGGAGTCAGGAAAACGTCTGGATGCTGACAAGATTTTCA
ACCTGCTGCCAGTTCAGTCGGTGTCATATTATCCTTACAG
TGTTGAAGATGAGCAGGCATGTCTGTATGTAAGACCTCGT
CGATCTGTGCTGACAGACAACACCTATGAAACCTTAAAGA
GTGTGGGGCTGAAAATGGCAACAAATTTGGCTGTGCGAGT
CCCTGATTGTCTTTCATACAGAGGCTTGACTTATCACAAA
AATTTAGTGATGTATCCTGACCATAGACCAGTACCAGTGA
TGTTTGCTCTAGGAATGGCTGGCGTTGATGGACCGGTTGG
AAATTCTCCATCAGTGACAATTAGGACAGTCTTTCCAGAA
ACATGGATCTGGGAGCTTGCTGAAGTGGGAGACTCTGGAT
CAGCTGAGGTTCCTGTTACAGTTCCTGACACCATCACGAC
TTGGGAAACAGAGGCCTTCTGTCTGTCCTCCACAGGTCTG
GGTTTGGCTCCTCCTGCTCAGCTGACAGTTTTCCAGCCCT
TCTTCCTGGAGCTCTCTCTACCTTACTCCATCATACGTGG
AGAGATCTTTGAGCTCAAGGCCACTGTCTTCAACTATCTA
TCCAAGTGCATCATGGTTAAAGTGAGTCCAGCTCCTTCCT
CAGACTACACTCTCAAAGCCTCCTCTGATGATCAGTATTC
ATCCTGTCTCTGTGCTAATGGAAGAAAAACCTTTAAATGG
ATCCTCACTCCTTCTGTTCTTGGAGTGGTGAATGTTACAG
TCAGTGCAGAGGCAGAGGCGTCCCAGACTGTGTGTGACAA
TGAGATTGTGAGTGTGCCAGAGCGAGGACGCATTGACATC
GTCACACGAAGTCTGCTTGTACAGGCTGAAGGAATTGAAA
AGACAGAGACCAACAGCTGGTTACTGTGTCCAAAGGGTGA
CAGTCTCTCAGAGAAAGTGGATCTTACTCTGCCTAAAGAT
GTGATAGAGGGATCAGCAAAATCCTCAGTTTCAGTCATTG
GAGACATATTGGGTCGAGCACTGCAGAATCTTCATGGATT
ATTACGGATGCCGTACGGCTGTGGAGAACAAAACATGGCT
GTTCTTTCTCCCAATATTTACATTCTGCAGTATCTGGAGA
ACACAAAGCAGCTCACATCAGCCATCCGAGAGAAAGCCAG
CAGCTTCCTTAAGAGTGGATACCAGAGACAACTGAACTAC
AAGCATTTTGATGGGGCTTACAGCACATTTGGTTATGGTG
ATGGGAACACATGGTTGACTGCCTTTGTCCTGAGGTCTTT
TGGCAAAGCTCAAAAATACACATTTATTGATCCACAAATT
ATTCAGAGTGCAAAGGATTGGTTAATAAGCAGACGGGATT
CAGACGGCTGTTTTATCCAACAGGGAAGACTGTTTAACAA
CAGAATGAAGGGTGGAGTGAATGATAATGTGACCATGACG
GCCTACATTACTGCATCACTGCTTGAACTGGAAACTCCTG
TCACAGATCCTGTCATCACTAAAGGTTTGTCATGCTTGAG
GTCTGTCATCGAGGAAGTCAAAAACACTTACACCACTGCT
CTGCTGGCCTACACTTTCAGTCTGGCTAGAGACACCAACA
CTCGACAGCAGCTTTTCAACAAACTGGAGGATCTTGCTAT
TTCAGATGGTCCTCTTGTCCACTGGTCTCGGTCTGCATCT
GCTGATGACTCTGCTTCTCTGGATGTGGAGATCAGCTCAT
ATGTGCTGCTAGCTGTTCTCACTGCAGATTCACTCACTAC
AGCTGATCTGGGCTTTGCTAACAGGATTGTCAGCTGGCTT
GTGAAGCAGCAGAATGCCTATGGAGGATTCTCCTCCACAC
AGGACACAGTGGTGGCTCTTCAGGCTCTGTCTTTGTACGC
CACCAAAGTGTTCAGCTCTGACGGCTCCAGCACAGTGACT
GTACAGTCAGCAGGAGACTCTCACCACTTTGATGTCAATC
AGGACAACAAGTTACTGTACCAGGAGAAGCAGCTGGCCAA
TGTGCCGGGCAAATACAGCATTGAAGTCAAGGGCTCAGCC
TGTGTGTCTGTGCAGATAGCTCAGTTTTACAACATTCCCA
CTCCTACTGAAGCTAAAACATTGAGCATTGATGCTAAGAT
TGAAGGAGATTGTGAAGCACTGGGACAAAATTTCATCTTC
GACTTCACTGTCAAATACGATGGGCCAGAGGAAAAGACTA
ACATGGCCATTGTAGACATTAAACTGTTATCTGGATTCAC
AGCTGATACATCTGCGCTTGGCACTTCTTCAGGAACATAT
GTATCACTTGTGGAGCGGGTCGATTCCAAAGATGACCATG
TCATTGTGTATCTGAAGGAGATCTCTAAAAATGTTGCAAT
GAATTACCAGATACAAATGAAACAGGTTCTACAAGTTAAG
AATCTTAAGCCAGCTGTGGTCAAAGTGTATGATTACTACC
AAACAAGTGATCAATCAGAGATTGAATACTCCTTCCACTG
TGAAGCACTGAAGAACATCAATTAATATTTTTCAGTGGTG
AAACATGTTTAAGCATTTATTTGTTTAATATTAAATAGTT
TTTCTATATTCTGGGCAAATTAATTCCCACCTATCAACCC
AACCCATCATATCTTAAGAAACTGATTTATTAAATCACAC
ACACACAAAAAATATTACATCATGATTTAACATGATTATT
AAAAGTGTTGAACCCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations