ZFIN ID: ZDB-TSCRIPT-131113-1098
Transcript Name: cldnj-201
Previous Name: ottdart00000056979

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056979 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056979|OTTDARG00000039730|ZDB-GENE-010328-10 cldnj|OTTDARP00000044707 cldnj-001 LG_ CR382327.27 Danio rerio protein_coding KNOWN, 1471 bp
TTCTTGTCTCTGTGGTCTCCAGCCCGCTCCTCCATGGCTC
TGCAGGTTTTGGGAATCACTCTGTCAATGATCGGCTTTGC
GGGAACCATCATCATCTGCGCGCTGCCCATGTGGAAGGTG
ACCGCCTTCATTGGCACCAACATCGTGGTGGCTCAGGTGT
TTTGGGAAGGCCTGTGGATGACCTGTGTGTATGAGCGCAT
CGGCCAGATGCAGTGCAAACTCTATGACGCCCTGCTGGAT
TTGGACCCCTTCCTGCAGGCGTCCCGCGGGCTCATAGTGA
CCACCATGGCTTTGGCCAGCTTGGCTTTCCTCATTTTTCT
GATTGGGGCTGATTGCACTAACTGTCTGAGTAACCCACGG
GCCAAAGGACGGATTGTGGTGGTCTCCGGCATCACCTTTA
TGCTTTCAGGACTGACCACTGTGGTGCCCGTGTCCTGGAC
AGCCGACTCCATTATAAGGGACTTTCACAATCCTGTAGTG
CACGAGGCTTTAAAGAGGGAGATGGGAGCAGCTCTTTATG
TGGGCTGGTTAACAGCCGGGTTTCTGTTTATTGGTGGAGC
AATTCTGTGCACCAGTTGCCCACCGGAGCGGGACAACTAT
TTACCACGGTATACTTTAACAAAATCTGGCACTCACAGTG
GCTATGCTGTAAAGAACTATGTCTGACAGGTAACACTCTC
TAAAATAGTAGACTGAACAAAAATTATTGGATTTCCTAGT
TTTTTTTTAGGGTAAACTATTCATTTGGGCTGAATTTAAA
CAAAAAAGGTGATTTTAGTAATCAACTTAATTTGAGTGCG
TTTATATTCAGCTCGTATGAATTGTTTGCAACCATTTACC
CTAAAAAATGTAGTAAATCCAATGAATATTTTTTTGTGTG
TATTGCACAAGTGTTATGCTGCATCCACACCAGACGCGGA
ACGCGATTCAAGCGTGAGTGATTTACATGTTAAGTCAATG
CAAACACGCAAATAGACATCCTGCGAATGGCGCGACGCAA
ATTGAACGTTTTGCGCGTTAAACAACCAGGAGCTTGCACT
TGTGGAGGTGTGATTGTGACGTATCCCCTGTTGTCGGTGT
TCCGGGGGAAATCCTTCAGCCGAAACCGACAAAAAGTTCA
TCAAACTGTGCTCAGCGCAGTCAGAAGCACCGCTGAAAGC
CTCCATCAGCCAGGTTAAGTTTCTGGAGGAGTTTATGAGC
TCACAGAGCTGGATGCACATCTGAAAGAATCTAGTGGACT
CAGACACGACCCTAAACGTATCGACGCTGTTTTTCAGCCT
TCATAAAGCACATTAACACTGTTATTTTTTTAATAAAATC
CATGTTAGCCATTTAGCTATGAAGCTAGAGTCACCGGGCA
GACAGAAGCCCTGCCCATCACGCGAATCCGCGTCTGTTCT
GAAGTGAATTTGACGCGCGAATGAAGCAGATTTGATGTGC
GAATGAAGCGAGTAACCTCAAATGTTCACGC

cldnj TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cldnj-201 1471
zgc:153990-201 (1)    Ensembl 2587
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cldnj-201 Contained in:
[BAC] CH211-235M3 (1)

Genome Resources: Vega_Trans:OTTDART00000056979 (1),  Ensembl_Trans:ENSDART00000081840 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AF359430 (1) 3542 nt
CITATIONS (2)