Transcript

flnca-201

ID
ZDB-TSCRIPT-131113-1030
Name
flnca-201
Previous Names
  • flnca-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056728 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056728|OTTDARG00000039519|ZDB-GENE-070503-1 flnca|OTTDARP00000044490 flnca-001 LG_ CU302436.11 Danio rerio protein_coding KNOWN, 9453 bp
ATTTTTGACAGTGTAGTTTATTTATTAATTGGAAATTAAT
TAACTGATATACATCAATATATAGTATTAGTACATAGGGT
AAACAGAATTTTTTAATTTCTACTCAGTTGCATTTGGTTT
GACATGTCATTTTTCATGATCATTTATAACAGCATGTAAC
AGCCTATATATACAGTATATGTGGCATGGACGCTATAATG
TAAAATGCTGGCAGCGTCACTCTCTATTTTTGCTGTGACT
TTGTCATGCAGAACCGGTGACCGCACAGTTTACAAATGAG
TGGACGAGCGGCCGCCCACTTCACTGACCAGACAGACAGA
AATAAGTGCGCTTTAATTGGCCAATCACAAACCCGTCTCG
CTCATTTCGACCAATCTGCTCCCTCATCGCGATCCTTCAG
AATTCGTCATATTCCAGTATACCATCATGACATCAGTGTG
ATGTAATCCCAGGGGTCCAGTGAGCATTTAAACCCCCTTC
CCTCACCCTCATCATCATTTCAAACAGAGTTTCACTCCTG
CAAACTGCGCAGAGACTTTTCCTATCTGAAGAAGAAAAAA
AGTGATATTCCTCCGAGTGTCCATTAAGAAGAAGCGACTA
CATTCAGCAAGGGGTTGAGAATTAAAAACGCGAGGCCGAC
CGCCTTGTAAACCGTAAATCGGATAATCTATCATCGTCCT
GACAGAAGATCACTTTTCGCAAGTGTCCGCGAAAGCTCGT
CTGTTTTTCTGCAACTTTTTGATCTGCTGAACGGCGCGCG
CGCTCCTGACACTCACGCGCAAAAGTGACGAGCTGCGAAC
TTCCAGCGTTATTAGTATAAAAGCAGCAGTCCCACCATGA
GCAATTACACACATTTAGACGACCTGCCGCCGCAGTATTA
CCAAGGCACAGACCTTGGAGAAGAGGAAGAGGAGGAGATG
CCGGCGACCGAGAAAGACCTGGCCGAGGACGCGCCGTGGA
AGAAGATCCAACAGAACACCTTCACCAGGTGGTGCAATGA
ACACCTCAAATGCGTTAATAAGGGCGTCACTGACCTGCAG
AAAGACCTGGGCGATGGCCTCAAACTCATCTCGCTTTTGG
AAGTCCTCAGTCAGAAGAAAATGTACAGAAAACATCACGT
CAGGCCAAACTTCAGACAGATGAAGCTGGAGAACGTGTCG
GTGGCGCTGGAGTTTCTGGACAGGGAGAGAATCAAACTGG
TGTCAATAGACAGCAAAGCCATTGTAGACGGGAACCTGAA
GCTGATTCTGGGTCTCATCTGGACGCTTATTCTCCATTAT
TCCATCTCCATGCCCATGTGGGATGATGAGGACGACGAGG
AGGTTAAGAAACTGACTCCCAAACAGAGATTGCTGGGCTG
GATTCAGAACAAAGTGCCAGAGCTGCCTATTAACAACTTC
AACAAGGACTGGAGGGATGGCAAGGCTCTTGGCGCCCTAG
TGGACAACTGTGCCCCTGGTCTGTGCCCTGACTGGCAAAC
ATGGGACCCCAACCAGCCAGTGGAAAATGCTCGTGAGGCC
ATGCAGCAGGCCGATGACTGGCTCGGAGTGCCACAGGTGA
TTGCTCCAGAGGAAATTGTGGATCCAGATGTGGATGAGCA
TTCAGTGATGACATACCTCTCTCAGTTTCCCAAAGCTAAA
CTGAAGCCTGGAGCCCCTGTTAAGCCAAAGCAGCTGTACC
CCAAAAAGGCCAAGGCCTATGGACCAGGTATTGAGCCTCA
GGGGAACATGGTTCTGAAACCAGCAGTATTTACTGTTGAA
ACACTGGAGGCTGGACTCGGTGAAGTGATTGTATATGTAG
AAGACCCAGAGGGTCACACTGAGGAGGCCAAAGTTGTTGC
CAACAATGACAAGAAAAGGACATTCTCTGTCACCTATGTG
CCTAAGGTTGAGGGACGTCACAAGGTGAAGGTACTCTTTG
CTGGTCAGGACATTGATAAGAGCCCATTCATGGTGAATGT
GGCGAAGGCTCTGGGTGATCCTAATAAAGTTCAAGCTCGA
GGTCCAGGTTTGGAGCCGGAGGGCAATGTGGCCCACAAAC
CTACCTATTTTGACATCTACACTGCAGGTGCTGGGGCTGG
AGATGTTAGCGTGGTCATTGTGGACCCGCAGAATAAAAAC
AACACTGTGGAAGTTATCCTTGAAAACAAGGGTGATAACA
TCTTCCGCTGCACCTACAAACCTGTGCTGGAGGGACCACA
CACCATCCATGTGACCTTTGCTGGGCAGCCTATTCCCAGC
AGCCCTTTTAAAGTGAACATCTCTGAGGCACATCTTAAAC
CACCCGGAGCTCCAAAGCAGATACCCCCTCAGAAAAAGAA
AGCCAGCAATGCCAATGCCTGCCGTGCAACTGGCAGAGGA
CTACAGCCTAAAGGTGTTCGGGTTAAGGAAGTGGCGGATT
TCACAGTTTTTACCAAAGGAGCAGGAACTGGGGAGCTGAA
GGTGTCTGTGAAAGGGCCTGGTGGAGTAGAGGTGCCTGTG
AAAGTGTGTGATGTTGGTGATGGAGTGTTCAAGTGTGACT
ATTGTCCTGTTAAGCCTGGAAAATATACTGTGAACATCAC
ATGGGGAGGACAACCTATCCCACGCAGCCCATTTGAGGTA
GAGGTCAGCAAGGAAGCTGGAACCCAAAAGGTGCGAGCTT
GGGGTCCTGGCTTGAAGACTGGAATGGTTGGCAAGTCAGC
TGACTTTGTTGTTGAGGCTATTGGCACAGAAGTAGGAACT
CTAGGGTTTTCTATTGAGGGCCCCTCTCAAGCAAAGATAG
AGTGTGATGATAAGGGTGACGGTTCCTGTGATGTGCGCTA
CTGGCCCACTGAACCCGGAGATTATGCAGTTCATGTTATC
TGTGATGATGAAGATATCAAAGACAGCCCCTTCATGGCCC
ATATCCTTCCAGCAGCCAATGACGTCTTTCCCGAGAAGGT
CAAAGCATTTGGGCCAGGCCTGGAGCCCACTGGAGTTACT
GTCAACAAGTCAACACAATTCACTGTCGATGCCAGAGAAG
CGGGCAAGGGAGGTCTGAAGATCTATGCTCAGGATGCTGA
AGGCTGTGTGATTGACATCCAGATTACTGATAAAGGAGAT
GGCACTTTTGTTTGTGTGTATGTTCCAACCAAGCCAGTGA
AGCACACCATTATAATTACCTGGGGGGAGGTCAACATACC
TAAAAGTCCTTTTAGAGTTCTTGTTGGTGAAGGCTGCCAC
CCTGACAAAGTCAAGGTCTATGGACCTGGAGTTGAGAAAA
CCGGCCTGAAGGCAAATGAGCCCACTTACTTTACTGTCGA
CTGTAGTGAAGCTGGCCAAGGAGATGTCAGCATTGGGATC
AAATGTGCCCCTGGTGTGGTGGGTCCAGCAGAGGCGGATA
TAGATTTTGACATCATAAAAAATGACAATGACACCTTTAC
TGTCAAGTATACACCTCCTGGCCCTGGCCGTTACACCATC
ATGGTTGTCTTTGCAGATCAGGAAATCCCCAGCAGCCCAT
TCAAAGTCAAGGTGGACCCATCTCATGATGCTGGTAAAGT
CAGAGCTGAAGGTCCTGGAATTAACAAGACAGGCGTTCAG
GTGGAAATTCCAACCCATTTCACCATCTTCACCAAAGGAG
CAGGAAAGGCAAAACCAGAGGTGCATTTCAAAACAGCTGC
CAAAGGAAATGCTGTAAAGGATTTTGAGATCATTGATAAC
CATGACTACTCCTACACTGTGAAGTACACAGCTCTTCATC
AGGGTGAGATGGCTATTGTGGTCACACACGGTGGGGATCC
CATTCCCAAAAGTCCTTTCAAGATCACAGTCGCCCCTTCA
CTTGATCTTGGCAAAGTCAAAGTTCAAGGTCTTAATGAAA
AAGTGGAAGTTGGAAAGGACCAGGAGTTTATTGTGAACAC
AAAAGGGGCTGGTGGACAGGGTAAGGTAAATGTGAGCATA
ACCTCACCCTCTGGCAGACCAATACCATGTAAGCTGGAAT
CAGACAAGACAAAGGAGGCCACCTGTGTGAAGTACATCCC
ACCTGAGGAGGGCCATTACAAGGTAGACATCACCTATGAT
GGGAACCCTGTTCCAGAAAGTCCCTTTTCTGTGGAGGGAC
TCATGCCTGCTGATCCTTCCAAGGTTCGGGCCTATGGACC
AGGACTGAAGGGTGGTATTGTGGGCCAGCCAGCAAAGTTC
TCTATAGACACGAAAGGAGCAGGTGCTGGTGGTCTGGGTC
TAACATTGGAAGGTCCATGTGAGGCTAAGATTGAATGCCA
AGACAATGGTGATGGAACCTGCTCAGTTGTCTACCTGCCC
ACAGAAGCTGGGGACTACAACATCAATATTCTTTATGGGG
AGGCTCATATCCCTGGCTCTCCTTTTAAAGCAGTTGTCAA
GCCAGCTCTGGATGCTGGCAAGGTTACAGCGAGTGGCCCA
GGACTGGAAAGGGCCAAAGCTGGCGAGGTGGCCAGTTTCA
CAGTAGACTGCAGTAGAGCCGGAGAGGCTGAACTCACCAT
TGAGATTGTGTCAGATTCAGGGGCTCAAGCTGAAGTTTGC
ATTCAAAACAACAAAGATGGGACATTTTCTGTCACCTACA
CCCCACTCTTTCATGGGGTACACACTATTACCATTAAATA
TGGAGGTCAGCAGGTGCCCAAGAGTCCCATACATGTGAAA
GTGGAGCCATCTGTGGACACTAGTGGAATTAAAGTCTATG
GACCAGGAGTTGAGCCCAAAGGGGTCCTCAGGGAGGTGAC
AACACACTTCATTGTGGATGCACGGGCCCATGCCAAGACC
AAAGGAGGCAATCATGTTAAGATTCGTATCATCAATCCAT
CAGGCGCAAACACGGATGCATATATCACTGATAAGGGTGA
TGGCACATATAGAGTGGAATATACAGCTTTCGAGGATGGT
TTGCACCTGATTGAGGTCTTTTATGATGAAGTTGCTGTTC
CTAAAAGTCCCTTTAAGGTGTCAGTTGTTGAAGGTTGTGA
CCCAACACGTGTCCGGGCTTATGGTCCAGGCCTGGAAGGT
GGGATAGTCAACAAACCCAACTGCTTCACAGTAGAGACAA
GGGGTGCTGGGACAGCTGGTTTGGGCTTAACCATCGAAGG
TGCATCAGAGGCTAAAATGCTCTGCAAAGACAACAAAGAC
GGTAGCTGCAGTGTTGAATATATGCCTTTCACTGCTGGAG
ACTATGATATCAATATTGCTTACGGAGGCCAGCCTATTCC
AGGCAGTCCATTTCGGGTGCAAGTTAAGGATGTGGTGGAT
GTCAGTAAGGTGAAGTGTTCTGGTCCTGGACTTGCAAACA
AAGTTACTGCACATGTTCCACAAACCTTCACTGTGGACTG
CAGCAAAGCTGGAGTGGCTCCTCTAGAGGTACAGCTGTAT
GGACCAAAAGGAACTCTGGAGCCTGTTGTTGTTAAAAACA
ATAGGGATGGAACACACACTGTCAACTATACCCCTGCGCA
GGAGGGGCCGCACACTGTGTCTGTTAAATATGCCAACCAA
GAAGTACCTAGCAGCCCTTACAAAGTTAATTCAGCTCCCT
CGCATGATGCCAGTAAGGTACGTGCTAGTGGACCTGGCTT
GGACACTACAGGAGTGGCTGCCAGTCTACCAGTGGAGTTT
ACCATTGACGCTCGTGATGCAGGGAAAGGCCTTCTGACAG
TTCAAATTCTAGATCCAGAAGGAAAGCCGAAAAAAGCCAG
CATTCATGACAACAGAGATGGAACCTACACCGTGTCTTAT
GTGCCAGACATGACTGGCCGCTACACCATAACTATTAAAT
ATGGCGGCGATAACATTCCATATTCACCTTACAATGTCCA
AGCCTTTCCTACTGGTGATGCCAGCAAGTGTCTGCTCACA
GTGTCTATTGGCGGACATGGTGTTGAAAGCCTTGGGCCCA
ATATCCAGATGTCGGAAGAGACAGTCATCACTGTGGATGC
AAAGGCTGCTGGAAAAGGAAAGGTAACATGCACAGTTCAG
ACCCCGAATGGCATGGAGCTGGATATGGATGTTACAGAAA
ATCCCGATGGCACCTTCGACATATATTACACAGCACCCGA
GCCGGGAAAATATGTCATCACAATCCGCTTTGGAGGTCAA
CACATTCCAAAAAGTCCTTTTCAAGTCATGGCTACAGATC
AACCTGTTGCACCGAGAGATGACACCAAACCCATGTTCCA
GCCTCTAAATTTAGTTATCCCATTTACTGTCCAGCAAGGA
GAGCTCAGTGGAGAAGTACGTATGCCATCTGGAAAGACAG
CTCGTCCGTTCATCAGGGACAACAAAGATGGGACAGTCAC
AGTGCAGTTTCAGCCTACAGAGAAAGGCCTGCATGAAATG
GACATAAAGTACGATGGCAACCACATCCCAGGAAGCCCTC
TGCAGTTCTACGTTGACGTAACAAACAGTGGAATGGTGAC
AGCCTATGGACCAGGTCTGTGTCACGGAACAGTCAATAAA
CCAGCTTCTTTCACTGTTGTCACTAAGAATGCTGGACAAG
GTGGTTTGTCCCTTGCTGTTGAGGGTCCATCTAAAGCTGA
AATCAGCTGTAAGGACAATAAAGACGGCACCTGCACTGTG
TCATACTTGCCGACAACACCGGGTGATTACAACATCATTG
TCAAGTTTGACAACAGCCATATCCCTGGCAGCCCCTTCAC
AGCAAAGATCACCGGTGACGATTCGCTCCGACGTTCTCAA
CTGAATGTTGGCACAGCAGCAGACGTCTCGCTAAAGATCA
CAGAAACAGACCTGAGCTATCTAACAGCTAGCATCAAAGC
TCCATCAGGAAAGGAGGAACCTTGTCTACTGAAGAGATTG
CCCAACCGGCACATTGGTCTCTCCTTTACCCCAAAAGAAG
TTGGGGAGCATGAGGTCAGTGTTAGGAAGAGTGGGAAACA
TGTAAACAACAGCCCTTTCAAGATTATGGTTGGACCATCG
GAAATCGGAGAAGCCAGCAGGGTCAAGGCTTTTGGTAAAG
GACTAGTTGAAGCACACACCTTTGAAGTGGCCGAGTTTTT
TGTGGACACTAGAAATGCTGGATATGGAGGACTTGGATTG
TCAATCGAAGGTCCAAGTAAAGTGGATATCAACTGTGACG
ATGTTGAAGATGGAACATGCAAAGTGACATATTGCCCAAC
CGAACCAGGCAACTACATCATCAATATCAAATTTGCAGAC
AAACACATACCAGGAAGTCCATTTACAGTGAAGGTAACAG
GAGAAGGAAGAATGAAACAGAGTATAACAAGGAAAAGGCA
AGCTGCCTCTATTGCATCAGTAGGCAGCACATGCGACCTA
AACCTAAAAATTCCAGGAAATTGGTTTCAAATGCTGTCAG
CACAGGAGCGCTTAACTCGTACCTTCACCCGCAGCAGCCA
CACTTACACACGTACAGAGCGCACAGAAATCAGCAAGACA
CATGGAGGTGAGACTAAGCGGGAGGTACATGTAGAGGAGA
GCACACAGGTTGGCGGGGGCGGTGGTGACCCTTTCAGAGA
TGTATTTGAATCCTTCCTGGGAAGAGACCGACTGGGTAGC
TTTGGTACAATCCGGCAAGAAGGAGAAACAGGGATCCAGG
GAATGACGGCGCAGGTTACCAGCCCTGGTGGAAATCTGGC
AGATGCAGAGATCGTTGATAGTGGAAACAGTACCTACAGA
GTCCGCTTTGTGCCTACTGAAATGGGTTCTCACACCGTCA
ACGTCAAATACAGGGGCGAGCATGTACCTGGAAGCCCCTT
CCAGTTTACAGTTGGCCCACTTGGGGAAGGAGGTTTCCAC
AAGGTCCGGGCTGGAGGCACAGGCCTAGAGAGAGCTGTCG
CAAAAGTTCCCGCTGAATTCAGTATTTGGACAAGAGAGGC
TGGAGCGGGTGGTCTGTCCATTGCTGTAGAAGGGCCAAGC
AAGGCTGAAATCAACTTTGAGGACAGAAAAGATGGATCTT
GTGGTGTCAGCTATGTTGTGCAGGAGCCTGGTGACTATGA
AGTTTCTATCAAGTTCAATAATGAGCATATCCCAGATAGT
CCCTTTATTGTTCCTGTTGCCACACTATCAGATGACGCAC
GACGACTTACTGTTACAAGCCTTCAGGAGAAGGATTTGAA
GGTTAATCAGGAGGCCTCATTCGCAGTTCAGAGGAATGGA
GCTAGGGGTGTCATAGATGCAAAAGTTCACGCTCCATCTG
GTGTGGTAGAGGAGTGTTATGTCACCGAATTGGATAGTGA
CAAAAATGCAATTCGCTTCATTCCACGTGAGAATGGTGTT
CACTCTATTGACGTGAAGTTCAATGGAAGCCACATCCCAG
GCAGCCCATTCAAAGTCCGTGTTGGAGAAGCAGAAAGTGT
TGGAGATCCAGGAATGGTGTCTGCTTTTGGTCCAGGACTT
GAGGGTGGACGCACAGGAGTCCCATCTGAGTTTGTCGTCA
ACACATGCAAGGCTGGTTCTGGTGCTTTATCTGTTACTAT
TGACGGTCCCTCAAAAGTCAAAATGGATTGCAATGAGTGC
CAGGAAGGTTACAAAATCTCTTACACACCAATGGCACCAG
GCAACTATCTCATTTGCATCAAATATGGTGGGCCGCAGCA
TATTGTTGGCAGCCCCTTCAAAGCAAAGGTCATAGGTATG
CGTCTTTCTGGGGGGCACAGTTTGCACGAAACTTCATCAG
TCATTGTGGAAACAGTTACCAAGTCCTCCAAGATGGCCGG
AGCATACAGCTCTCTGACCAGCTCTATGCCAACATCAGAC
GCCAGTAAGGTCGTGTGTCACGGTGCTGGCCTTTCCAAAG
CCTTCGTGGGTCAGAAGAACAGTTTTTCTGTAGACTGCAG
TAAAGCAGGTACAAACATGCTCATGGTTGGTGTCCACGGT
CCTAGAACTCCATGTGAAGATGTGACAGTCAAGCATATGG
GAAACAAGCTTTACAACGTGACCTACACCGTGAAGGAGAA
AGGAAACTATGTAGTGATTGTTAAATGGGGGGACGAAACT
ATACCAGGGAGTCCTTTCCATGTAAGCGCTCCTTAAACAC
AAAGTCAAACGCTTAGAGTTTCTAATTCAGAAAAAAAGCT
TAATCCAGGGAAAAGAATGTGGAGTAAAAGGCTTATTTTA
AGACTGAATCTTATTTCAGAGGCTAATGACTTTTATTTAA
TGCTACCCTGTTTGACGCAAGTGTATTTTAATACTGTTTC
GGATGCTGTTTATTGTAAGGGTGACAATTTAAGTTTAATA
ATAATTAAATGGGTATATCCACCTAATTCTGTTTTGTTTA
ACCACCTAAAAAGAATATATGTGTATTTTACTGAGGGAGA
TTTATTGTTCTTCGAGGCACTTTTGATGGTGATGGGACAT
CACAGCAATATTGGTTTTGTGTTCCGACAATGTATAGATG
TATCTGCTTTTATATGCTTTATAGAATGTTATTTTATGAT
CTTAACCAACTATTTATATGCATTTGAAAACTGAAATAAA
GAATAAAACTAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations