Transcript

afap1-202

ID
ZDB-TSCRIPT-130528-74
Name
afap1-202
Previous Names
  • afap1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000058395 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058395|OTTDARG00000040603|ZDB-GENE-100316-6 afap1|OTTDARP00000045649 afap1-001 LG_ BX465854.7 Danio rerio protein_coding KNOWN, 3128 bp
GTAGCTCACAGGCCAGAGGAACAAGAACAACAGAGGTGGC
CGTTATCAAGTACACGCGGATGCAGGACAGTTCCGTCATT
TTGCCATAAAGACATGACGGAAAGCAACGAAGAAGCGATG
GAGGAGTTGTTGGCAGAGTTACGAGTGTTTCTGGAGTTGT
TGGACAGAGAGTATTTGACTGCTGGAGTGAGAGAGAAGAA
ACAGCAAATATTAAACATCCTGCACAGAGTTCTGGCCACT
AGAGAACCCTCATGTAAGACAGAGATACACACATCTCTCC
CGGCCCCTCCCCAGATGCCCCTACCAGAGATTCCTCACCC
CTGGATGCCTCCAGACAATGGGCCTCCTCCTTTACCGAGC
TCCTCTCTTCCTGAGGGTTATTATGAGGAAGCGGTTCCAC
TGGGTCCTGGGAAAGCACCAGAGTACATCACCTCTAATTA
TGACTCGGACGCCATGAGCAGTTCGTATGAGTCATATGAT
GAGGAAGAGGAGGATGGGAAGGGTCAGAAGATGCGTCACC
AGTGGCCATCTGAGGAGGCCTCCATGGATTTGGTAAAAGA
TGCACGTATCTGCGCATTCCTGTTGCGAAAGAAACGCTTT
GGTCAGTGGACCAAACTTCTATGTGTCATAAAGGACAACA
AACTGTTGTGCTACAAGTCCTCTAAAGACCAGACTCCACA
GATGGAGCTCCTTCTGTCCGGCTGCAGTATCACACACATC
CCCAAAGATGGCAAGAAAAAGAAGCATGAACTGAAGATCG
TTCATCAGGGAGCTGATGCTCTAGTGCTTGCTGTACAGAG
CAAAGAACAGGCCGAACAATGGCTAAAGGTGATGAAAGAA
GTCTGCTCGAATGGAAATGGAGTGGTGGATTGCGACGGAG
CTGGCTCTGGATCCACTGTTCACAAGGCAGAGCTGGAAAA
GAAGCTGTCCTGCGATCGGCCCAGTTCAGATGGAGAGCCC
TGCCATGAAAACGGCATCTCAGATGGCAAAGATCCAGCTA
AAGGCAAGAAGAACTCTAAATCAGAGCAGAAAGGCACTGT
GGGACGTGTGACTGGAAAGAAAATCACAAAAATCATCAGC
CTAGGCAAGAAGAAACCATCAACAGATGAACAGACCTCAT
CAGCGGAGGAAGATGTCCCAACATGTGGCTATCTTAACGT
GCTGTCCAACAACCGCTGGAGAGAGCGCTGGTGCCAGCTA
AAAGACAACCAGCTGTTTCTGCACAAAGATCGAGCCGATC
TGAAGACGCACATGGCCTCTCTGCCGCTGCGGGGCTGTGA
GGTCATTCCAGGCCTGGACTCCAAACATCCCTTCGCCTTC
CGTCTACTGCGCAATGGACAGGAGGTGGCTGTTCTGGAGG
CCTCCTCCTCTGAGAGTATGGGAAGGTGGTTGGGGGTCTT
GCTGGCTGAGACGGGCTCCACAACAGATCCCGCTGCACTC
CACTACGATTACATTGACGTAGAGACCACTGCTAACGTCA
TTCAGCTGGCAAAGCAGTCATTTTGTTTCACCAGTAAGCG
TGCAGTTTCTCCTAACCCATACCTGGATAATCCGGTCAAT
GGTTATGCCTGTCCCACTGGGGTCGCTCTGCATTATGACG
ATGTGCCCTGCATCAATGGAACGATACCAGATGCACACTA
CTCCTCCCCAGCTTCAGGGGGCCGCCGCTGGAAAGACGAA
TCTCATTATGAAAATACAGATCTTTATGAAAACATGCCCT
CCCCCAAACTAGCAGCTCGCTACTCTCCCAAGTCCACCCG
CACATCATCTTCCTCGGGGCATTACAGCACACCAAACTCC
ACCAAATCTCTGTCTTCTTCCTCTGCTGCTAATACTAACA
CTAACCAGATGAAAGGGAAGAAAGGCTTGATCACCAATGG
TTTCGGTGCAAAGAAGTTGGACAAGAATCAACCCAAAAAG
GCCAATGGCATTAGCAGCACTCTGCCAGTGAAGCGTAACA
ACTCCAGTGTAGATCAGTATAAGTACGGGAAAAACAGAGT
GGAGGCAGATGCCAAGAAACTCCAAGCCAAAGAGGAGGAG
CTGATGAGGAAGAAACAGGAAATCCGAAACCGCCTGACCC
AGCTGAAAAAAGACAGAAAGGACCTCCGCACTGCTTTAGA
GAACAACACAGCTAAGCGTTCCCAGGCATCTTTGACAGAG
AGGCTTAAGAAAGTGGAGGATGAGTGCAAACTGAAAGAGG
AAGAGCGAGTCAGTCTGGAGCTGGAGTTGACGGAGGTCAA
GGAGAGTCTGAAGAAAGCTCTGAATGGTGGTGTCACCCTG
GGCCTGACCATTGAACCCAAAACAGGCAGCTCCAGCCCAC
AGTCTCCAGTATTAATGAGGCGAACGGTGGACAACTCGCC
CATTTCCAGCTGTAACACCAGTGACACGGAGACCTGCTCT
CTGCCGGTCAACAGTGCGTCTCTGCTGCGCCGCCAGACAC
AACAGAAAGCCTCACCTGTGCGAGGTCACGTCCTCAGAAA
AGCTAAGGAATGGGAGATGAAATCTGGCACATAAGTTCAC
TTTTCCACAACCTTTCACTTTTGTTGTATCTATTTATTTA
ATTTTGTCCATATATGAGTGATGTTGAAATTGAATTGACT
GAACCATAGACACAGTTTTCCAAAAAGAACTCTTGACTGA
ATCCAGTTCCCAGTGCTGCTGTTTTGTTATAATCATTATA
TCATTGGACCATGCTTTTACTAGAGCAATTAATTTACATG
CATCATTTCATTTTATTTAAAATTCCTAAAATATGAGGAA
AAAAACACTAATAATTTCTTACAATTGGGTCAAGAGCAAT
GCCACAATACCAAGTTACGGTAGTAAATACCCATACACTT
CTGTTCAAAATTCATATTTTTAAGGTAATTAATAGTTGTT
GAGCAAGAATACATTAAACTGTTCAAAATTGGGAATAATA
ATACAAATAATTAGGTAAAACTTTAGTTTTAGGACCAATT
CTCACTGCTAACTTTCAGCTTATTTCATATCTGTTAATAT
AAAGGCTGTTTGTTTGTACATATAAAGTACATCCCTAATC
CTAGCCAATAACTAAACCAAACTAAGCAACACAGGCTCAT
TCTGAAAACGTAGCATTATAAATGTTTCTGGAGATCACAA
ATTATGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations