ZFIN ID: ZDB-TSCRIPT-130528-70
Transcript Name: cdca9-202
Previous Name: cdca9-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058383 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058383|OTTDARG00000040601|ZDB-GENE-090706-4 cdca9|OTTDARP00000047865 cdca9-003 LG_ CR848021.10 Danio rerio protein_coding KNOWN, 903 bp
CAGAAGAAAATAATTGGCGAGCACCTGTGGTGAGCGCCTT
CTCTTAAGTTAGTACTTTTCAGAAAAAAAATTAAAAACAT
CTTTCAGGTATTAGCATGGCTCCACGAAGAACTAGAAAAG
TGAGTCAGGATTCAGACGGTCAGGTCGACGACCAGCACAG
CTTTGAGCAGAAGATCAGACTCACCAAGAGAAAAGAGCTC
TTCATACAACAGTTTGAGAAGGAAGCGCAGGACCGGATAA
ATGAAATGGAGGCCAATCTGAACAAATTATTAGCAACAGT
GGACAGAGTCTTCAAAATAGAGCTGATGAAAATGCCGCTG
TCACTTCACACCACGCTGATAAAAGACCTGATGAACGATG
ATGACACGTCTGTTGGCGAGGTGACGATGGCTCTTAAGTG
TGCCTCTCCAGAAATTCAGAAACCCCTGTCTAGAAAGCCA
AGCAAAAAAGCTTTAAATGCCTTGGCAGGGCAACAAAGGT
CGTCGAGTCAAAGTAAGACTCCAATTGAAGGCCAAAAGAA
ACCTACAAAGAAGACCCTGCACAGCAGTAAAAGCACTGGG
AGTCTGAGATGTGCCTCAACCATCAATGCCAAAAGAACTC
AAGGACGGGTTGTCAAACTCAGTGACCAAGCAAATGCTTT
AGGGGTTCAATTTAGACAAACAAGTCGCTCTGTTGGAGAT
GAATTGATGATGGCTACAGCCACAATAGTAACTTCCCATG
GAGAAGACAATAAAGATGAGATCAATGTTGAGCTGCTCGA
TGACGCAGCCGTAAATCAGATGAGGAAGATCAAGGAACTG
ATGGACTATCTGTGTAACAAAGTGAGGATCAATAACACAT
GCTAATGCTTTTTTTAAATCCGTCTTCTTAAATAATATGA
ATAAATAAATGTTATTATAAATG

cdca9 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cdca9-201 (1)    Ensembl 865
cdca9-202 903
cdca9-203 (1)    Ensembl 980
ncRNA cdca9-004 (1) 400
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cdca9-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000058383 (1),  Ensembl_Trans:ENSDART00000152930 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH549196 (1) 928 nt
GenBank:EH570318 (1) 923 nt
CITATIONS (2)