ZFIN ID: ZDB-TSCRIPT-130528-323
Transcript Name: cdca9-203
Previous Name: cdca9-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058381 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058381|OTTDARG00000040601|ZDB-GENE-090706-4 cdca9|OTTDARP00000047864 cdca9-001 LG_ CR848021.10 Danio rerio protein_coding KNOWN, 980 bp
TCCAATAGGTGGCAGAAGTGTACCTTTTAAATTGATTTGC
CAATCGCAATTAAAAGCAGAAGAAAATAATTGGCGAGCAC
CTGTGGTGAGCGCCTTCTCTTAAGTTAGTACTTTTCAGAA
AAAAAATTAAAAACATCTTTCAGGTATTAGCATGGCTCCA
CGAAGAACTAGAAAAGTGAGTCAGGATTCAGACGGTCAGG
TCGACGACCAGCACAGCTTTGAGCAGAAGATCAGACTCAC
CAAGAGAAAAGAGCTCTTCATACAACAGTTTGAGAAGGAA
GCGCAGGACCGGATAAATGAAATGGAGGCCAATCTGAACA
AATTATTAGCAACAGTGGACAGAGTCTTCAAAATAGAGCT
GATGAAAATGCCGCTGTCACTTCACACCACGCTGATAAAA
GACCTGATGAACGATGATGACACGTCTGTTGGCGAGGTGA
CGATGGCTCTTAAGTGTGCCTCTCCAGAAATTCAGAAACC
CCTGTCTAGAAAGCCAAGCAAAAAAGCTTTAAATGCCTTG
GCAGGGCAACAAAGGTCGTCGAGTCAAAGTAAGACTCCAA
TTGAAGGCCAAAAGAAACCTACAAAGAAGACCCTGCACAG
CAGTAAAAGCACTGGGAGTCTGAGATGTGCCTCAACCATC
AATGCCAAAAGAACTCAAGGACGGGTTGTCAAACTCAGTG
ACCAAGCAAATGCTTTAGGGGTTCAATTTAGACAAACAAG
TCGCTCTGTTGGAGATGAATTGATGATGGCTACAGCCACA
ATAGTAACTTCCCATGGAGAAACTCTGTTTCTTTCCGAGG
ACAATAAAGATGAGATCAATGTTGAGCTGCTCGATGACGC
AGCCGTAAATCAGATGAGGAAGATCAAGGAACTGATGGAC
TATCTGTGTAACAAAGTGAGGATCAATAACACATGCTAAT
GCTTTTTTTAAATCCGTCTTCTTAAATAATATGAATAAAT
AAATGTTATTATAAATGCAA

cdca9 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA cdca9-201 (1)    Ensembl 865
cdca9-202 (1)    Ensembl 903
cdca9-203 980
ncRNA cdca9-004 (1) 400
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cdca9-203 Contained in:

Genome Resources: Vega_Trans:OTTDART00000058381 (1),  Ensembl_Trans:ENSDART00000153254 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH537195 (1) 947 nt
GenBank:EG587252 (1) 628 nt
GenBank:BI979958 (1) 487 nt
CITATIONS (2)