ZFIN ID: ZDB-TSCRIPT-130528-7
Transcript Name: fscn2b-201
Previous Names: fscn1l-001, fscn2b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000047362 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000047362|OTTDARG00000033644|ZDB-GENE-040426-1740 fscn2b|OTTDARP00000037212 fscn1l-001 LG_ CR932362.10 Danio rerio protein_coding KNOWN, 3389 bp
TAGAGACTGGGGAGAAGGACAAAGGCAGGAGCACTATACA
ACGGGTGGATTACTGGGACTCTGTAAAGGGTCTCTAGTGT
AAGAATACATCCAATATATATCGAGACAGGAGAAAATAAC
CATAAAAAGAAACATAAGAGGATAGAACAACAGGTGAAAG
GAAAGTCGAAAAGGTGTCAAAGTACACTCAAAAGGCTGCA
CTGTACTTCAAGGAACATTAATATGGCACATGCTGACCTG
GCATCTTAGTGGGTACCTTGTGATCTCGGAGTAAAACAAG
GTGTCTGTTTAAGGGATACACAAGTTCTGAGGATGTGACT
GAAGTAAACTTAGAAGAGGACGAGGAGGAGACAAACTAAT
CAGATGTCATACTGAAGGACTGAGATGAGTAAGGCTTCAA
GAAGAAGTACAACAGTGTGACTCAGTCTTGAGCAGCATCT
CTTTAAGAGATCAGTAATCCCACAATCCCCAAGGCAGCCA
CTGGAGAGGACAAGAGACAGAAAAACGCAGGTAAATTGAG
AAGGAAAGGGAATGAGGCAGAGAAAGCGGGTGAAAGAGGC
ACAGAGGAAAACTAACCATTGGGATCAGGGTGACGTCAGC
GGCTCTCTGGATTGAGGTGTTGAGTCCTCCTGATTATAAT
CTGATCTGATTAGGAAACACAGGGAAAAAATCTCCAGAGC
CTCTGCAAACTCTCCAGGGAGCAAGACGTTGTTTTTACTC
AGCGGAAAGGCCAAGGACCAGGAACAAAACTAAAAGAGGA
ACGTAGATGCAGTAAAGGCCTATTTCTGAAAAGAAACATT
AAGGAGTCTAGTGAAGTAGACTTTAATTTACTTGTCCAAT
TAATCAAGTGGCATAGAGGAACCAGCTTTGCAAGTCTGCT
GGCTGTTCAGCTTTTTCTCTGGACTTCAACACTCTCTGGC
TTGTGGGTTGTAAGCCAGGATGCCCTCCAATGGCAGCAAA
GCCCTTAAGCTTCAATTCGGGCTTATTAATCATGAGAATC
GCTACCTAACGGCGGAGGCCTTCGGCTTCAAGGTGAACGC
TTCAGCTCCAAGCCTCAAGAAGAAGCAGATCTGGACTCTA
GAGCAAGACGATCAGGATGGTCAGGTGGTTTACCTTCGTA
GTCACCTAGGGCGCTACCTGGCCTCTGACAAAGATGGCAA
GGTAAGCTGTGAGGCTGAGACTAAAGAGAATGACTGTCGC
TTTTTGATTGTGGCACAGTCAGATGGCCGCTGGGCCCTGC
AGTCTGAGCCATATTTGCGCTTTTTCGGAGGTTCAGAAGA
CTACTTGTCGTGCTTTGCTCAGACCATCGGCGAGGCAGAA
CTATGGGCCATGCATCTAGCCCTACACCCACAAGCTAATC
TGCTTAGTGTGGCCCGCAAACGATATGCCCACTTGGCATC
GCCAGAGGGAGAGATTGCTGTAGACTGCAACATCCCATGG
GGTGTTGATGCACTTCTAACTCTTGTGTACATGGACGGCA
AATATTGTCTTAAGACCAGTGACAGCCGCTTCCTTAGCAA
TGATGGGAAACTGTCCTCTGAAAATGGACGTGGCACAGGC
TACACCTTGGAACTGAAATCAGGCAAATTGGCCTTCAAGG
ACTGTGAGGGGAAGTACTTGACCCCCATGGGGCCCACTGG
AACTCTGCGCTCTGGACGATGCTCCAAACCTGGCAAAGAT
GAGCTGTTTGATCTTGAGGAAAGCCATCCGCAAGTGGTGT
TTCAGGCCGCCAACAACAGATTTGTCTCCATTCGACAGGG
TGTGAGCGTCTCAGCCAATCAGGACGATGAGACAGACATG
GAGACGTTTCAAATGGAAATTGATAAAGATACGAGAAAGT
GCAAATTCAGAACCAATGAAGGAAATTATTGGACGCTCGT
CGCTCATGGAGGCATCCAGTCAACAGCCACAGAAGCCGGT
GCCAACACCATGTTTGACATCGTGTGGCTCGGTCGACGGG
TGGCACTGCGGGCCAGCAATGGAAAATATGTATGTACTAA
GAAAAACGGCCAGCTTTCTGCAGTCAGCGACTCTGTGGGC
GAGGACGAGCAGCTGATTCTGAAGCTGATCAACAGGCCCA
TTCTGATCCTGAGGGGAGAAAACGGCTATGTTTGCCACCA
CAAAAACTCAAACACGCTGGACGCCAGTCGCTCGGTTTAT
GACATTTTCACACTGCAGTTCAGTGATGGTGCATACCATA
TTAAAGGTGCTGGCGGGAAATTCTGGTATGTGTCCAGCAG
TGGTTTGGTGTGTTCAGACGGAGACACGCCTGAGGATTTC
AGCTTTGAGTTCTTAGAGCACGGACGAATAGCGATTAGAG
GCAAAAACGGCAAATACCTGCGGGGAGATCAGGGCGGGAA
TCTGAAAGGAGACGGAGAGACGGCGGACAGCTCTTCCCTC
TGGGAATACTGACATCTTGTGGACACTGAACGAACTGCCA
CATTTTCAGATGAGAGAAAATACATTGGTAAAACTGAGGT
GTTATGTTTGGACATCTGTTTTCCCATCAACCGGCATTTG
ATTTAGAATCAGTATTCAGCATTACGCATGTATTATTTAT
TTTTTCTGGTTTATAGTTCTATAAAACAGGAGCCTGTGAA
TACCAATAAGACAAACACGACAAGACCTGAACCTTTATCA
TAACAGCTCACTATCGCACACTATTCCATAACATGCTATA
ATTGTGGCAAAATTACATATGTTGTATTCCCTATTGTGAT
TTTTTTGCTTTCTTAAAGGGATAGTTCACACAAAAATAAA
AATATGCTCACTATTTACTCTCCCTCAAGAGGGTTCAAAC
CCTAGTTTCCGTCTTCTGTTAAGATTTTTTTAAGAAAGCT
GAATTCCTGTAACCATTGACATCAGTAGTTGGACAAACAA
ATACCATGGAAGTCAATGGTTACCAGGTTCTAGCTCAAAA
TAAATTTTTATCAGAATAAAAAAAATCAAACAAGTTTGGA
ACGTGAATAGAGAGGAAGAGTTTTTATTTTTGGTTGAACC
ATCTCTTTAAAACCATCTGGAAAGATTTTACAGTCATTTC
AATAAAATCCTGTCTCTTAATTCTGGAGGAATGAATCTCA
TTTGCTGTAAGCTGCATCATGTTTCTGCTCTGAATTGAAT
TGGCTTCCAGTAACTAAGCATTGAATCCTAGGCAAGTGGT
GCCTGTCGCTATGATCTCTATATGCTGGTTGTATTCCCAC
CGAGAAAACACAATACTATTCATGAAGACTTGTTTCATAA
ACGAACTGCTGCTGGCTGCAGTCAATAAGATAAAAATATG
AAACCCAATAATTCTCTACACTGGATGTGCACTGTGGTCA
ACCAGAGCAGTTATCTTACAGAGACATTCTATGGTAACTA
ATTTTGTAAAATAAAAGACATCAAGGGTG

fscn2b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA fscn2b-201 3389
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fscn2b-201 Contained in:
[BAC] DKEYP-92C5 (1)

Genome Resources: Vega_Trans:OTTDART00000047362 (1),  Ensembl_Trans:ENSDART00000111717 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EU580143 (1) 1472 bp
GenBank:DT059634 (1) 767 bp
GenBank:BI879774 (1) 579 bp
CITATIONS (2)