ZFIN ID: ZDB-TSCRIPT-130528-575
Transcript Name: capgb-201
Previous Names: capg-002, capgb-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058376 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058376|OTTDARG00000040596|ZDB-GENE-030131-8541 capgb|OTTDARP00000047862 capg-002 LG_none CR925753.7,CR848021.10 Danio rerio protein_coding KNOWN, 609 bp
GCCAGGTGAACTCACTCACACACACACCTAGGTGCAGGAA
CAGGCAGGATGGAGCCGGACTCTGACAGCATGCCGGAGCA
GGCCGAAGGAGCTTTGCAAATGCAACCATTTCAGGCGGCT
CCAGGACAGTTTGGCGATGAGGTTCGTCAGCCAGGACTTT
ATTGCTGGAGAGTGGAGAAAATGAAGGCTGTTCCTCTGAA
TCAAGCTGAAGTGGGGGCTTTCTTCAACGGAGACTCATAC
CTGGTGCTGGATAACAGGGGAGATCAGGGAGCAGACCTAC
ACATGTGGATCGGAGAGAAATCGTCGCGTGACGAGCAGGT
GGCTTGCGCCATGTTGGCCACACAACTGGATAATTTCCTG
GGTGGAGATCCAGTCCAGCACAGGCAGGTTCAGGGTTACG
AGTCTCCAGAATTCATGAAACTCTTCCCTCGAGGAGTCAG
TTATAAGGAGGGAGGAGTGGAGTCTGGCTTCAGAAGAGCG
CAGTCTGGACCTGGACCTGTTCAGAGGTTATACCAAATCA
AAGGGAAACGCAACATCAGGGCAAAGGAAGTAGATTTGAG
CTGGCAGAGTTTTAACAAGGGCGACTGCTTCATACTTGAT
CTGGGCGAG

capgb TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA capgb-201 609
capgb-202 (1)    Ensembl 1804
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
capgb-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000058376 (1),  Ensembl_Trans:ENSDART00000171725 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CN015905 (1) 953 nt
CITATIONS (2)