ZFIN ID: ZDB-TSCRIPT-130528-321
Transcript Name: capgb-202
Previous Names: capg-001, capgb-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058375 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058375|OTTDARG00000040596|ZDB-GENE-030131-8541 capgb|OTTDARP00000047861 capg-001 LG_none CR925753.7,CR848021.10 Danio rerio protein_coding KNOWN, 1804 bp
TTGATATATTTTCTTCTTGTTTAGGCACAGAAATTTTTCC
TGCTGTCAAATTTAGTCAAAACAAACAAATAACACGTTTA
GGAAATCTGTGCACTCCACTTTGCCTCTTTTCCTCATTTT
TTGGCATGTTTGTTTAAATGGGGGTGTTTTCAAGGGGGGT
GGACCAAAAACCCATTCAGGAAGTCAGTTTGTACATTTGC
CTCTCTTCAACAAATTCTCTCTTCCTTTCCTTCTTGAAAC
TTTGCAGAGTTCTTCAACTTCAACTTCATCAGCAAGAATG
CAACCATTTCAGGCGGCTCCAGGACAGTTTGGCGATGAGG
TTCGTCAGCCAGGACTTTATTGCTGGAGAGTGGAGAAAAT
GAAGGCTGTTCCTCTGAATCAAGCTGAAGTGGGGGCTTTC
TTCAACGGAGACTCATACCTGGTGCTGGATAACAGGGGAG
ATCAGGGAGCAGACCTACACATGTGGATCGGAGAGAAATC
GTCGCGTGACGAGCAGGTGGCTTGCGCCATGTTGGCCACA
CAACTGGATAATTTCCTGGGTGGAGATCCAGTCCAGCACA
GGCAGGTTCAGGGTTACGAGTCTCCAGAATTCATGAAACT
CTTCCCTCGAGGAGTCAGTTATAAGGAGGGAGGAGTGGAG
TCTGGCTTCAGAAGAGCGCAGTCTGGACCTGGACCTGTTC
AGAGGTTATACCAAATCAAAGGGAAACGCAACATCAGGGC
AAAGGAAGTAGATTTGAGCTGGCAGAGTTTTAACAAGGGC
GACTGCTTCATACTTGATCTGGGCGAGACGATTGTGTCAT
GGATTGGATCTCAGGCAAACATCTTCGAGAAGCAGAAGGT
GAGAGAGATCGCCTCTCTCATCAGAGATACAGACAGACAC
GGCAAAGCTCAGATCACCAATGTTAATGAGGGAGAGGAGA
CACAGGAAATGCTGAAGGTTCTTGGTCCAGTGCCAGAGCT
GAAAGAAAGCACTCCAGAGGAGGACAGCAAAGCAGATGCA
TCAAATTCAGCCTCCCTTTACAAGGTTTCAGATGCCACAG
GGTCAATGAAGTTGACCAAGGTGTCAGAGAAAAGTCCATT
TGCCAAGGACTTGCTGGTGCGTGATGACTGCTTTATCCTG
GACAATGGGGCCAACGGAAAAATCTTTGTTTGGAAAGGAA
GTGGAGCCAACGCAGAAGAGAAGAGGGTTGCTTTAAAAAT
GGCAGATGACTTCATCCAGCAAATGAATTACCCAAAGATG
AAAACACAGGTGGAGATTTTACCACAGGGCAGAGAAACTG
TTATCTTTAAACAGTTTTTCCAAAGCTGGAATTAAACCTC
ATTTCACTGCATGATCAGATAATAAACTGCACTCAACCAG
TTGTCAAAAAACTGTAATTTACTTCAATAAGGCCATTGAT
ATATTGCGTAATAAACAAATGTACAGTTGTAAAACAAATC
ATTCATGGAGGTTTGCAGTAATAATGGATATGAGTAAGAG
AGGCTTTACTATTTGTTTGGTACCGCGTTTGTACGGCTTT
TAGAGGGTGTTTATATTGGTCAATGCTAATTTTAAAGAGC
TTTTAATAATAATTTCCCCCTTTTTTGATTGAGAGGGTCA
AATCTACTGTTATGTTGCAGGCTTAATGAACGCAAACCCT
TGAGTAGATGCCATTTCTACTTAAAAACAGAATAATGTAA
CCACTTTCAAGCCAATTTACTATTTCACAATCTCTGTGAA
ATGGCTTTTTTTCTCATTTTGTACTCATTTTGTGTATGTA
ACTGCAGCATGGAAATTAAAATGCAAATGCAACAACAGCA
AAAA

capgb TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA capgb-201 (1)    Ensembl 609
capgb-202 1804
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
capgb-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000058375 (1),  Ensembl_Trans:ENSDART00000172053 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC049461 (1) 1635 nt
GenBank:BC071365 (1) 1635 nt
GenBank:BI842809 (1) 638 nt
CITATIONS (2)