ZFIN ID: ZDB-TSCRIPT-130528-559
Transcript Name: si:dkey-22l1.1-202
Previous Names: dkey-22l1.1-001, si:dkey-22l1.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058327 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058327|OTTDARG00000040573|ZDB-GENE-130603-74 si:dkey-22l1.1|OTTDARP00000045602 DKEY-22L1.1-001 LG_none BX255913.8,BX649353.5 Danio rerio protein_coding NOVEL, 787 bp
CGCGTCTGCGATGAGCAAAGGATGGAGATGGTTAAACATA
TGCCAAAGCTACCGAAGGACAGGAATGACATTTAGGAATC
GCATGCCTCTGGGTTTCTTCTTAATACCTGACACATGGTT
TGATGATCTCTCGGCGTGTTTTGATCATTTTAAATTGGCT
GTAAGACTCAGATGACAAGAGGTGTCCCATGGCTTTACAT
CATGATTTACCACAAGATATAGAGCAGAGGGAAACACCGG
TGGAACTTGACGCTCTGCTTTTGGATACGGATATTATATT
TGGATTAACCAGTCATTATTTGAGGAGAAAGCAGCAGGTC
ATTGAGGTTTCAGAAAGCAGTGAATCAGTGCAGAGTCCGG
CACTCAATCCTAGGAAAAGGCTTCATTCGGCAGAGGAAGT
GCAATGCGGCAGCCGGCCAAACCCGGAGGGTGCCGGTTCA
GCGTCCGTAACAGAGTTAAGTTATTCTGAGAACAAGCACG
GGAGGGAAAGCCTGTGTCAGCGATGTCAAATCATTGCGAA
CCAACTGAACAGGCAGGCGCGCGAGCTGGCCGAGCCAGGA
ACTCTGAAGGTCTTTTTTTGCTGGAGAACAGTAGTGGCCC
GATGGACTATAAAGCTGAAATGTTTCAATTAGTCACACAC
CTTTCAGTCACAACAGGATTCAAGGTTTGTTTTGGGATAG
ATGTAGACTTCACCCACTTGTTTTGGGAAATTCCTGTATT
TTCCATTCCCTCCCTTATGAACTGAAACAACTCCATTCCT
GTACAATCAATAAATCTCTGTTAAATT

si:dkey-22l1.1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA si:dkey-22l1.1-002 (1) 739
mRNA si:dkey-22l1.1-202 787
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-22l1.1-202 Contained in:
OTHER si:dkey-22l1.1-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000058327 (1)
  • Ensembl_Trans:ENSDART00000153459 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH487934 (1) 870bp
    GenBank:EH514320 (1) 853bp
    CITATIONS (2)