ZFIN ID: ZDB-TSCRIPT-130528-52
Transcript Name: si:dkey-22l1.1-002
Previous Name: dkey-22l1.1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058328 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058328|OTTDARG00000040573|ZDB-GENE-130603-74 si:dkey-22l1.1|no_translation DKEY-22L1.1-002 LG_none BX255913.8,BX649353.5 Danio rerio protein_coding NOVEL, 739 bp
GCGTCTGCGATGAGCAAAGGATGGAGATGGTTAAACATAT
GCCAAAGCTACCGAAGGACAGGAATGACATTTAGGAATCG
CATGCCTCTGGGTTTCTTCTTAATACCTGACACATGGTTT
GATGATCTCTCGGCGTGTTTTGATCATTTTAAATTGGCTG
TAAGACTCAGATGACAAGAGGTGTCCCATGGCTTTACATC
ATGATTTACCACAAGATATAGAGCAGAGGGAAACACCGGT
GGAACTTGACGCTCTGCTTTTGGATACGGATATTATATTT
GGATTAACCAGTCATTATTTGAGGAGAAAGCAGCAGGTCA
TTGAGGTTTCAGAAAGCAGTGAATCAGTGCAGAGTCCGGC
ACTCAATCCTAGGAAAAGGCTTCATTCGGCAGAGGAAGTG
CAATGCGGCAGCCGGCCAAACCCGGAGGGTGCCGGTTCAG
CGTCCGTAACAGAGTTAAGTTATTCTGAGAACAAGCACGG
GAGGGAAAGCCTGTGTCAGCGATGTCAAATCATTGCGAAC
CAACTGAACAGGCAGGCGCGCGAGCTGGCCGAGCCAGGAA
CTCTGAAGGTTTGTGCATTCAACTATACCATTAAATCAAT
TCATCTCAGGGCCTGTTTCATCATGAACACAGTGACAGTG
GTGTAGAAATAATCGTTTTAATCTTTGCAGTAATTAAAAG
AAAAAAAAACTACTGTAACCATACCCATTGCATTCAGAAT
AAAGCATTTAGATGAGTTC

si:dkey-22l1.1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA si:dkey-22l1.1-002 739
mRNA si:dkey-22l1.1-202 (1) 787
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-22l1.1-002 Contained in:
OTHER si:dkey-22l1.1-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000058328 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EH536709 (1) 779bp
    GenBank:EH557960 (1) 763bp
    GenBank:AL918459 (1) 536bp
    CITATIONS (1)