header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-130528-557
Transcript Name: asb2a.1-003
Previous Name: asb2a-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058321 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058321|OTTDARG00000005599|ZDB-GENE-030131-5355 asb2a.1|no_translation asb2a-003 LG_ BX255913.8 Danio rerio protein_coding KNOWN, 345 bp
AGGAACAATGTGGAAATCTGTGAGATGCTGATGAAAGCTG
GAGCCAAAGTCAGCTTGCCTAACAAGTACGGAATCACTCC
TATCTTTGTAGCGGCTCAAAGTGGAAAAGTGGAAGCACTT
CGCATGCTTTTAAAAAATGGCGCTGATCTCAACAGTCAGG
CCTCAGATGGAGCCACAGCGCTGTATGAGGCCTGTAAAAA
TGGTCATGAGGACATTGTAGAGTTCCTTCTCTCTCAAAAT
GCAGATGCCAACAAGGCAGGAAAAACAGGACTCTTGCCGA
TTCATATTGCTGCCCAGCGTGGCAAAGATGGGTATGATTT
AACAGTACAGAAATATAAAGTATTT

asb2a.1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA asb2a.1-002 (1) 651
asb2a.1-003 345
mRNA asb2a.1-202 (1) 3957
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
asb2a.1-003 Contained in:
[BAC] DKEY-85N7 (1) (order this)

OTHER asb2a.1-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000058321 (1)
  • Ensembl_Trans:ENSDART00000153184 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AI667222 (1) 347 bp
    CITATIONS (2)