ZFIN ID: ZDB-TSCRIPT-130528-303
Transcript Name: asb2a.1-202
Previous Names: asb2a.1-001, ottdart00000058320

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058320 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058320|OTTDARG00000005599|ZDB-GENE-030131-5355 asb2a.1|OTTDARP00000045600 asb2a-001 LG_ BX255913.8 Danio rerio protein_coding KNOWN, 3957 bp
GTGACAGTTAAAGGCCTCTCTTTTGCTGAGAGCTAAACAG
GTCACGGGCTGAGCTGGTGTTAAGTGTGTCACTAGACATA
GGGGAACAACAAAACAAGTTTTTCTGTTTGGAAATCTGAC
ACGCTGCTGAGAAAAGGGGAAAAGAGAGGTTATTTCAGTT
GGAACCATCATGGCAGCCACCCATGTGTCTTTACCGGGAA
CCACAGGCACCAACCTGGAATTTGCTGACTACAGTCTCTA
TAGCAACCTGTCTGATGATGAGCTCCTGCACCTGGCAATC
GAGCGGAGTCTTGCTGATGCCCACAGCTCTGGGTCGGGCA
CTGAAAACTTAAAGACCCCTGCAGCTCTGAACAAGCCATC
ATCAGCAGCAGCAACAGCAGCATGCCAGACACCATCACGT
CCACCCCAACAACAACAGCGGCAGCAGACAGTACAAGCTG
CATGTCCTGCTAATCCACCCAGAGAAAAAATTGATCTTGA
AAATGTGTGTTCAGTGAGTCATTTTGTGACTGGATATGGC
AAGCCAATGGTGGCGTACCGAAGATATGATGGATCTATGC
AACTCGTGCCTGAACCTGAAGAGGAACTTGAGCCCATTGC
TAAGGCCATTTCGGAGGGGGATGTAGGGACAGTGAGACTA
ATGGTCAAGCAACCAGGCTGCAACCTTCTTAAACCTAATA
AAGAAGGGTGGATTCCTTTGCATGAGGCGGCATATTATGG
ACAAGATCAATGCGTTAAAATTCTCCTGAGAGCTCAACCT
GGGATGATTAACCAGCGCACTTTGAGAGATCAGACTCCTT
TAATGTTAGCTGTGTCCAGAGAGAATCTGGCATGTGTGGA
GATTCTTCTGGAGAAAGGAGCTGATCCTGAGATTCCCAAC
AAGGAAAAGGAGACTCCACTTTACAAAGCTTGCGAGAAGG
AAAACCCAGCATTGGTTGCCATGTTACTGAATCACGGCGC
CTTGGTGAATAAGAGCTGTATTCAAGGCTGGACGGCTCTC
CACGAGAGTGTGTGCAGGAACAATGTGGAAATCTGTGAGA
TGCTGATGAAAGCTGGAGCCAAAGTCAGCTTGCCTAACAA
GTACGGAATCACTCCTATCTTTGTAGCGGCTCAAAGTGGA
AAAGTGGAAGCACTTCGCATGCTTTTAAAAAATGGCGCTG
ATCTCAACAGTCAGGCCTCAGATGGAGCCACAGCGCTGTA
TGAGGCCTGTAAAAATGGTCATGAGGACATTGTAGAGTTC
CTTCTCTCTCAAAATGCAGATGCCAACAAGGCAGGAAAAA
CAGGACTCTTGCCGATTCATATTGCTGCCCAGCGTGGCAA
AGATGGCAAAGACCTCCTCACTTTTGGGTGTACCCGCAAA
AATATCAGTGCAACTAAAATTATAGCCATGCTGATCCCAG
CCACAAGTAGGGCCAGAGTGAGGCGTTCTGGTATCAGCCC
TCTCCATTTGGCTGCGGAGCGCAACAGAAATGACATTGTG
GAAGTACTGATCGAGGCCGGCTTTGACGTTAATGCCATGT
TGTCTGAGGATCGTTCCATGATGTATGAAGATCGGCGGAG
CACAGCTCTCTACTTTGCCGTCATTAACAACAACATCGAA
GCTACCACTATGCTTCTGGAGGCTGGTGCCAACCCAAACC
TGGATACGTTCAAACCGCTGCTGGTGGCACTGAGGCAGGG
CTGCATACAGACTGTGACTCTGCTGGTGGAACATGGCGCT
GATGTTAATGCCAACATCCCAACTCATCCAACTAGCTTTC
CAGCCTCCGTTATGTTCTGTATGAAGTACTTGTCCTTACT
GAAATATCTGATGGATAACGGCTGCGATGCATTGTCATGT
TTTAATTGTGTTTATGGTAGTAATCCCCATCCACCTATAA
AACCAAGGCGGAATCCAAGATATGACTCAGATGAATCCAG
AGAAAAGACCTGTGTTCTGTTCTGCGAGGTGATCTCCACC
GAAAACTACTCGCGCTGGTCAGGACCGATTATTGACGTGC
TTCTAGACTATGTTGGACATGTGAAACTCTGCGCACGACT
GGTTGAACATCTGGACAGTTACCACGAGTGGCAGTGCATC
AAAGAGAAAGCAATGCCTCCACGCCCACTCATGCAGCTGT
GCAGACTGAAAATCCGTACACTCCTCGGAATCAACAGACT
GAAGAAAATTCACAAGCTTCCGGTTCCTCCGAGGCTGATC
AAATTCCTAAATCATCAAGAACGAGAATATGAAATGTAGA
CCTGCTTTTATTCAATGCAGAAAGAACAATGACATAAGAA
AATTATCTGTCCATATGCTTCTGTTCATAACTTGCACTGA
GTTAAAATAATTGGAACTAAATTGACATAAATTTTCCAAT
CAAATCTGCTGCTTAATGTAAACAGGCCATAAATGTTTAA
ATGCAAGTAGCTATCAGACATAAACAGAATATAGCGGACA
TGTATTAAATAGATTCAGTGAAGACATATTAATTTATCTT
GTCTATATGTGTATTCTTATTTAAAATGTAGGAATATTAT
ATGTACGAAAAATGATATCATGTGAAAGAAAATAATAACT
GCTATTTTTTTGCAATATAGTAGAATGTATTATGAAATGT
GTATAGTTTTGTATTAGGTTTTGTATTTTTTACTTCTTGC
TGATTTTTAGTCAGGTCGGTGTATATTTCAATGTTTTGTC
TTGCTTACAAAGCAAACTAAGTGGCAAAGCTACGTGAGAT
AATTATCTGAATGATTTCCAACGACATGATGATAATAATT
AAAGTGTTATACAATAATTAAAGTTACAGTATTTGAGATT
CAATTAGCCTATTCCTTTACAAATTTTGAAGATTTTCTAC
AAACTAGTGTATATGTATGAATAATAAATAACCTAACTTC
CATTCCTGGGTATAATGATGTACAAAATTACCGCCCTTTT
TCATTTCATGGGTTGTTCTTGGGGTTTTTCAGCTACAGTT
TTTTTCTGTTCTTTAATAAACGATTAACACAGTTCTTGAA
ATGTTATTATTAAAAATAAAAAAACAACACCTCCAAACTG
AACCAGTGTGAAAAAATATAATAAGAAAACAGTTTTTCTC
AAATTAAAAATGAATGTCCCTCATTTGCTCATTCACCTAC
TTGCTCATCTGCACACGTTTTCAATCAACATTTCCAACGT
TACTTCAACGTTAAAAATAAAACTGAGAAAGAAAACAAAA
CTCATTTACTTACTAACAGTTCTAACGGTGAACAAAATTA
CGGAATACGTTGTTCTTAACCAAGTACGTTACTTTAAATA
ATGTAGCTACTGAAAACAACACTTTGTGGACCTTACTATT
CAGAGTCGGAAGTGACGTCATGAGTTATTCAGTGTTCATT
CGGATTTATTTATTACAAAAGCAATAGCACAAAAAAATGA
ATAAAAGGTCTATACAGTCATTATAAAAAGACTATTGTAT
TATTCTGTGTATGTCGATTAAGTGTTAGCTACAACGTGGG
TAGAATAATTGGTTCTGGTGTCGTCACGTATTGCCCCCCT
AATTGTGTCTGTAACTTAGGGAAGTAATTAAAAATACTTT
TAAAAACAATAAACGTGTAAACAAAATTCGTACAAATACC
TGTATTTACATAATGTTGTCAGCAGTAAAGCTGTCAGCAA
TACTCAGAGAGAGAACACAGAAGCTGCCTCTATGTGTCCT
TGAATGTGGGTGTTGTTAACCCTGATCTGAACTTGATCAG
GTCAGTTCGGGTAGCAGCCAGACAATGTACTTTCCAGATG
GCCAGACTTGAGAGCAAAACTGATTGCCCAGATTCAGTGT
TGCCAACTTTTTCCGATGGTAAGTAGCTAAAGCCTGTATG
GTATGGAGGCGAAGGCCGTAGCTAAATGTTGCCAGATGAC
GTCAAGCACTAATTTGCATATCAGTGACGTCATCACGTAG
TATCTGACAAGAAACCCCGTCATGTTTCTACTCCCTG

asb2a.1 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA asb2a.1-002 (1) 651
asb2a.1-003 (1) 345
mRNA asb2a.1-202 3957
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
asb2a.1-202 Contained in:
OTHER asb2a.1-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000058320 (1)
  • Ensembl_Trans:ENSDART00000148361 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK026169 (1) 792bp
    GenBank:CF997855 (1) 783bp
    GenBank:DT061785 (1) 756bp
    CITATIONS (2)