ZFIN ID: ZDB-TSCRIPT-130528-51
Transcript Name: asb2a.1-206
Previous Names: asb2a.2-002, dkey-85n7.4-002, ottdart00000058325

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058325 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058325|OTTDARG00000040571|ZDB-GENE-130603-17 asb2a.2|OTTDARP00000045601 DKEY-85N7.4-002 LG_ BX255913.8 Danio rerio protein_coding NOVEL, 517 bp
GCGGTTGGCACGTCAGAACGCGAGTCGAAGTTCGTCATCG
AAATGGACTCGGAACAGGGCACAACTACTGGATTTGACAA
CTGATTACGTTTACTTACGGCATAATCTTCTAAATATGGC
TAATTCCGGGTAAACCTAAGGCTTGGAATAAACAGCTAGG
TGTGACGTTTTGCTCATTGTGCTAACTTGAACACCAGTGC
TTACAACAGTGCAAAATGGCAGCAGCCAGAGTGACAATGG
CAGCATCAAGGACAACAAGCAGAGAGCTGGAGGACTACAG
TGCTTATGCACATATGTCAGAAGAACAGCTGTTGCAGTTA
GCTATTGAACGTAGCCTGGCTGAAACAAATTTATCTCCAT
GGCAAGATCGGCAAGTGCAGGCCCACACACAGCCAGCTGT
CCCTAAAGGTGCACAAAGACCTCCAGCCAACCCTAATTCA
GCCAACCCACCAAGTGAAATTAAGAAAACAAAGATCGACA
GAGATGTTCAAGATCATATTTTTAGTAAAGACAGTGA

asb2a.2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA asb2a.1-205 (1)    Ensembl 2447
asb2a.1-206 517
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
asb2a.1-206 Contained in:
[BAC] DKEY-85N7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000058325 (1),  Ensembl_Trans:ENSDART00000153277 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EB926393 (1) 517 nt
CITATIONS (2)