ZFIN ID: ZDB-TSCRIPT-090929-618
Transcript Name: asb2a.1-205
Previous Names: asb2a-001, asb2a.2-001, si:dkey-85n7.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000006069 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000006069|OTTDARG00000040571|ZDB-GENE-130603-17 asb2a.2|OTTDARP00000005415 DKEY-85N7.4-001 LG_ BX255913.8 Danio rerio protein_coding NOVEL, 2447 bp
AGCAATTGCTGTAGAGAGGAAGAAGCAGACACGCATGCAA
CACATTCAGCCTAACTGTTGATATCCTGCAGAAGGTGCAA
AATGGCAGCAGCCAGAGTGACAATGGCAGCATCAAGGACA
ACAAGCAGAGAGCTGGAGGACTACAGTGCTTATGCACATA
TGTCAGAAGAACAGCTGTTGCAGTTAGCTATTGAACGTAG
CCTGGCTGAAACAAATTTATCTCCATGGCAAGATCGGCAA
GTGCAGGCCCACACACAGCCAGCTGTCCCTAAAGGTGCAC
AAAGACCTCCAGCCAACCCTAATTCAGCCAACCCACCAAG
TGAAATTAAGAAAACAAAGATCGACAGAGATGTTCAAGAT
CATATTTTTAGTAAAGACAGTGACAAGGTAATTGCATGGA
CAAGACACAATGGACACCTGCGGGTCACAGTGCAAACTGT
AAATGATTTGGACCCCTTTCTCTCAGCTATTTGGAAGGGA
GATGCAAAGACTTTACAAGACCTCGTTCATAGCAAATCTA
AATATCTCGAAGAGCCCAATAAAGATGGCTGGTTACCGCT
TCATGAATGTGCCTGCAACGGCCATGTGGAGTGCCTTAAG
GTTTTGCTCAAAGCCAAACCAGATACAATCAACAAAAGAA
CACACAGAAATCAGACCCCGCTCATTCTGGCTGTGGGTCG
CAAGCATGTTGCTTGTGTCGAGCACCTTTTGGAGCAAGGA
GCTGATCCAAACATTGCGAATAACCAGTGGGAGACCCCAT
TGTACAAAGCATGTGAGAAAGGTAATGAAGAGATAGTGGA
ACTTCTATTGAGATATGGAGCTACACCAACCAAAGCCTGC
GTTCAAGGTTTAACTCCACTACATGAAGCAGTGAGGAACA
AAATGTTGGAGAGTTGTAAGATGTTGATACACGCAGGGGC
AAAGCTGTGGGCCCAAAATGTTTATGGGATTGACTCTTTG
TTTACAGCTGCTCAGTGTAACGCTGTCGATGTGCTAAACT
ACCTTATACATAAAGGAGGTAATATCAATTCCAAGGCTAA
TGATGATGCAACAGCCTTGTTTGAGGCCTCCAAGAATGGT
CATGTTCAAGTTGTCAAGATCCTCCTGTCAAAAAGAGCCG
ATGCTAACAAAGCCAACAAATCTGGATTGCTTCCTATTCA
CATCGCATCAAAGAATGGCCATGAGAGCATTGTCGCCATG
TTAATTCCTAAAACCAGCACAACCAAAGTGAGACGCTCCG
GCATCAGTCCCCTTCATTTCGCAGCTGAGCGTAACAGAGA
TGACGTTCTAGAAATACTGATTGAGGCTGGATATGATGTC
AATGCCATGCTCTCAGACGACTGGTCAAAACTGCATGAGG
ATCGCCGCAGCACAGCTTTATACTCGGCTGTGGTGAACAG
AAACATTGAGGCCGCCATTATGCTTTTAGAAGCTGGTGCT
GACCCAAACCTGGACATATTCAACCCTCTGCTTGTGGCTG
TGAGGAAAGGAAATATAGAAATGGTGACCCTGTTGGTGAA
GTACGGTGCCAATGTTAATGCCATGCTGCCCACTCATCCC
ACCAGCTTCCCAGCAGCTCTGGTTTTCTGCATGAGGTACA
TTATGATGATGAAGTATCTTCTGGACAATGGCTGTGATGC
ACTGGCATGTTTTAAATGTCAGTATGGAAGTAATCCTCAT
CCCCCTTTAAAACCAAGATCAACTGGAAGAGAAACAATGT
ACTTATTAAATGAAGATCCATCAGACTACTGTGTACAGTT
TTGTGAGATAATCTCTGCTCCCTCAGTCAGTGGTTTGGTT
GGACCCATTATTGACACTTTACTTAACTACGTGGGTCACG
TTAAACTCTGCTCTAGATTAACCGAACACCTAGACAACAA
CAAAGACTGGGCTCATGTAAAAGAAAAAGCAGTTCTTCCA
TGCACATTGATGAATCTGTGCAGAATAAAGGTTCGCCAAC
AACTCGGAGTCCACAGACTGCAGCAAATCCACACTCTTCC
TCTACCAGCAAGACTAAACAAGTTCTTGATTTATGAACGA
GAATCATTTGAGGGAATCCTGTCATAAAATTCTGTGCCAT
TTTTCAATATTTACAAAACATGTTGTCTTGAATTCTTTTG
GTACAGACATACAGTTAGTTATAACAAATTTAAACGATGA
ATTAAATGTTTAAAATCAAATTTGAAAATGAAACGTTTAC
TATTTTCAATTTGCATAGCTAATTATTTTAATTCATGCGT
GTAAATGTAAATAACATATTAAATGTATATAGTATACATA
CTGTATAAAATGTCAAAAGAGGCACACAATTTGATATAAA
TCAAGTGCTGGCTATGTATTTTTACTTGCATAAACAAATG
TACTGTACTTGCACTTTAAGATTTTTTGTAAATAATAATT
GGATTCAACAATAATTAAAAATTTCGGGTATTAAAACTGC
AATGAGC

asb2a.2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA asb2a.1-205 2447
asb2a.1-206 (1) 517
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
asb2a.1-205 Contained in:
OTHER asb2a.1-205 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000006069 (1)
  • Ensembl_Trans:ENSDART00000152917 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK026169 (1) 792bp
    GenBank:CF997855 (1) 783bp
    GenBank:DT061785 (1) 756bp
    CITATIONS (2)