ZFIN ID: ZDB-TSCRIPT-130528-457
Transcript Name: grin2cb-202
Previous Name: grin2cb-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058795 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058795|OTTDARG00000040779|ZDB-GENE-100308-2 grin2cb|OTTDARP00000045916 grin2cb-001 LG_none CU151887.11,CR385040.11 Danio rerio protein_coding KNOWN, 4940 bp
GGCTGAAGAATGTACAGCTTGGGCTCGGGCTCGGATGCAT
CCAGCCGGCACAGGCTCTAGGAGGCTGAAATGGCCACTCC
TCGAGGGTGTTTGGGTCCCTCTCTTCAGCTCCTCTTCTTC
TTTCATCTGTTACTCAATGTAGTGCCTCGCTGCCGGGGAC
GTCCATTCTTTGGCCCACCTTCGGTCAACGTGGCTGTGGT
TTTCAGCGGCTCGGCTCATCACAGTGAGATCAAGGGCCGT
CTGAGTCCAGAAAACTTCCTTGACATGCCGCTAGAAGTGA
ACCCCATCACCGTGCTGGTGAACGACACAAACCCCCGAGC
TTTACTCACACGTCTCTGTCAGACTATGGCGGCGGAGAGC
CTTCACGGCGTGGTGTTTGAAGACGACGTGGACTCTGAGG
CCGTGGCTCAAATCTTAGACTTTGTTTCCTCTCAGACGTC
CATCCCCATCGTAGGCATCAGTGGAGGTTCAGCGGTGGTC
ATCCCACATAAAGCGGACGGTTCCACCTTTCTTCAAATGG
GAGCTTCTATAGATCAGCAGATAAATGCAATGTTCAAAGT
GATGGAGGAGTACAACTGGGGCAACTTTGTGGTGATCACA
AGCCTGTATCCCGGCTATGAGACCTTTGTGGACTACATTC
GCTCATTCACGGACACAAGCTACTTCCTGTGGGAGCTGCA
AGATGTGCTGAGTTTCGAGATGTCGGTGGGCGCAAATGAC
ATCCGCACACGTCGACTTCTACAACAAGTGGACTCTCAGG
TGTATCTAGTGTACTGTTCCCACGAAGAAGCACAGTATTT
GTTTAGGATGGCCTCTGATGTGGGGCTTTTGGGGCCTGGA
TACATCTGGATCGTCCCTAGTCTGGCTGTGGGCAACCCTG
AAGCGGCCCCTCCAGCCAGCTTCCCAGTGGGCGTCATCAG
TATTATCACAGACCGCTGGAGGAAAACACTGCGCCAGAGG
GTTCGCGAAGGAGTGGCAATCATAGTGAAAGGGGTGCACA
GTTTTCACAAGCACAGAGGATTCATTCCCGAGGGTCACAG
TGACTGCAGTAGTCCTGTCAAATCATATGCCAACAATTCT
CTCTTCAGGCATATGCTGAATGTGTCATGGGAGCATAAGG
ATCTGTCCTTCAACTCCGATGGCTATCTCACTAATCCTTC
CATGGTGATCATTGCTCTGGATCGAGAGAACCACTGGGAC
AAGGTGGGAAGCTACGAGGGAGGAATTTTGCAGATGCGTT
ATCCTGTATGGCCTCGTTATGGCAGCTTCTTGGAGCCCGT
GTCAGACAACCGGCATCTGACCGTGGCCACGCTGGAGGAA
CGGCCTTTCGTCATCGTAGAGAGTGTTGATCCTGCCACCG
GCACTTGTGTGCGCAATACTGTGCCCTGCCGTCGACAGTC
CAACAGGACTGAAAGTATAATCGGTCACACTGAGCCTTAC
ACCAAACTCTGCTGCAAAGGCTTCTGCATAGACATCCTAA
AGAAGCTCTCACGCACCATTAAGTTTTCATACGACCTTTA
TCTGGTCACCAATGGGAAACATGGCAAGATGGTCCGTGGC
GTCTGGAATGGGATGATTGGAGAGGTCTTCTACAAACGTG
CAGATATGGCTATTGGCTCTCTAACCATCAACGAGGAGCG
CTCAGAGATTGTTGACTTTTCAGTGCCATTCGTGGAGACT
GGGATCAGTGTTATGGTGGCCAGAAGCAATGGAACAGTCT
CACCTTCTGCCTTCCTGGAGCCTTACAGTCCAGCCGTGTG
GGTTATGATGTTCGTAATGTGCCTGACTGTTGTGGCAGTC
ACCGTGTTCGTCTTTGAGTACTTCAGCCCTGTTGGCTACA
ACCGGAGCCTTGTCAGTGCCAAAGCCCCTGGGGGTCCAAC
CTTTACCATTGGGAAGTCTGTTTGGCTCCTGTGGGGAATC
GTCTTCAACAACTCTGTTCCTATTGAAAACCCCAAAGGAA
CAACCAGCAAAATTATGGTCCTAGTCTGGGCGTTCTTTGC
TGTAATCTTCCTCGCCAGCTATACAGCCAATTTAGCGGCC
TTCATGATCCAAGAGCAGTACATTGACACAGTGTCTGGGC
TTAGTGACAAGAAGTTTCAAAAACCCCAGGAACATTATCC
TCCCTTTCGCTTCGGAACGGTCCCAAATGGCAGCACAGAG
AGGAACATTCGAAGCAATTACCCTGACATGCACACCCACA
TGATCAAATACAACCAGAAGGGAGTGGAAGAAGCTCTCAA
CAGCCTTAAGACAGGGAAGTTGGATGCCTTCATATATGAT
GCAGCAGTTCTTAATTATATGGCTGGCAAGGATGAGGGCT
GCAAGCTGGTCACCATTGGTAGCGGGAAGGTGTTTGCTAC
CACAGGCTACGGCATTGCTCTGCAGAAAGACTCCCGCTGG
AAGCGCCCCATAGACCTGGCTCTTCTCCAGTTCCTGGGAG
ACGGGGACACACAGAGACTGGAGACAGTATGGCTGTCTGG
AATATGCCAGAATGAGAAAAACGAGGTCATGAGCTCTAAA
CTAGACATAGACAACATGGCAGGTGTTTTCTACATGTTGC
TTGTGGCCATGGGTCTCAGCCTGCTGGTCTTTGCTTGGGA
ACATCTACTTTACTGGAAACTGAGGCACTCTGTTCACAAA
TCTGATCGTTTAGACTTTCTGCTGGCCATTAGCAGGGGCA
TATACAGCTGCTTCAATGGAGTCGAAGACATTGGCAGATC
TACTGGCATACAGAATCCAGATATCACCGCCAATTACGCC
CAGGCCAACATGCTGAAAATGCTTCAGACAGCCAAGGACA
TCGTCTCCTCTGCCAAAGTTGAGAACTCTTTGGATAACGC
CACCAAGACCATTGAGAACTGGAGCAGACGGAGTGGCAGT
CTCCCAGCCCGTATCCCACTGGTGACAACCACAGAAAAAG
TTCCCGGTCACTTCTCCTATATTGCTAATGTCGCAGAGAA
CCACATACCTCACATGCAGCGTTCCATAACTCCACCTTTC
ACACAACACACCACAACCACCAGCCCACCGCTAATGGTAA
ACCACAGAGTGTTAACACGGCCAACTCCTCTACGCTACAC
GCTTCCCGCCAGGACCAGGGGTCTCTACGATGGCATGCTT
CCTGTATCCAGTCTAAGCACACCGCATCTTGCCATGCATG
ACCCTCCATCTGACCTGGCTCACACAGGTTCCTCCTTCGT
CCCATATAGAGACATTTACACCGAACACCACAAGTCCTGT
CACAATGACTTCTCAGATGCAGTCAGGCGGAAAAAGAGGC
CCCAAAATCTCCTGGTGGAGTCTATGGATTTGAGGGGTCT
TCATGATTATAAAGACCAATTAACATGTCACTCCGAAGCA
AACAGTTTTCCTGAAAATCATCTTTCCTCATCCTTCAGTG
AAAATCCCTTTGTGGTAGCAGATGCAGCTTGTAACTCTTG
TGCCAAAACGTACTTTGACCCTGCATTTGATGAAATACCT
TTGATAGGGAAAAGAAAGCTTCATCGCAGACCATCCTTCC
TGAAAGCCACTTGGGGTCCAGACAGAGTAAAATTCCCAGG
TGACAGACCCACTGCTGCACCCCCTTCTAGAGTAACTATA
CCTGATCTGTTCCCTTGCGTGGATGTACACGGACGGGTGA
GGAACACCATGTGTTATGCTCAACCAATGGATCACACCTA
CCTTCATGCCTTCCGGCGAAACTCCAGGAAAAGTCAGAAG
CTGAGACATAGCCAGTCCACCAGGCTGCCTTCCTACAAGG
AGGCGATTTTCCACAATGTGGCAGCAGTCAGGAGGGCATC
CAGCTTGGTGCATAGACCCTACTCCTACCCAGAGCTGCCA
GTCTACCAGAGCCCACTGTCATATGGACCAGCTGAATTAT
GCAACATCTTCCCGTGTATGGGACATCCCAGTGACAGTGT
ATATGGAGGGTATAGGGCACCCGCACAGCTACAGGATGGC
CATCTAGTGCCTGTTCCAGGCAGCAGGGTTGTTCATAGCA
GCCCTATTGTGCCCATGACATGGGGCAGAATTTCCAGTCT
GGAATCAGAGGTGTGAACTTGTCCTTCCATGTGCCAATTA
TGAACTATTTGGACCACAAGCTTCTACTGACTTAAATGAC
TTTGCCTTTAAAGACCAATTCACACTGCACCGACAGACAG
CGACCAGCGGCAACAGACACGTTCATCTGGTTACCTCCAT
TGGCTTTGGTCAGTGCTTTTATTTAGTTATTGGATGTGGT
AAAGCTGCATTTGTCAGCAATGTCTAAAGTGAAGTGACTG
TTAACAATGGTTGGAATCACTTGGAGGAGTGTGAATTGGC
CTTAACAAGATAGTTCACCCCAAAATGAAATTTGCTGTTA
ATTTAGTCACCCTCAGGCCACCCCAGATGTGTCTTTTTTT
CTTCAGATGTTTTTTTTTTTTACTCTTAATGTGCTGTTAG
CAGTCAACTTGCTTTTTTTAATCACCAAGGACCACAGTTT
CAGCTAAAAACTTTTTTAACGTTCCATTCAAGAAAAAATT
CATCTGGGATAGCCAGAGGTTGAGTAAATAAACTGAACAT
TTTCATTTTGGGATGAACTGTTCCTTTAACACGAGCAGAA
CACAAACCATGGTTATTGTTTCATTTGTTTTCTTTTCTTA
ATATATTTTTTTAAGTGCAATAATGTAATAATTGAGGGAT
TTATTTAGGGAAATATTCAAACGGTTAAATTTGAAACGTA
TGGACATGTAGAACTGTAAACTATTAGCTGTTCTCTTTAG
TCCACCAAATGCAATATATTCCTATATGTGTATTGGACAG
GATCAAAGGGTGTTTCTTAAGAGGTTGTAGTAGTGAAGTC
AAACCGGGACACTAAACTATACGAAGTGTTCATTTTGAAG
TACATTTGCTATTATACAGTGTGTGATTCTCTATGATATT
GAAATTTTGTAAACACTTCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
grin2cb-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000058795 (1),  Ensembl_Trans:ENSDART00000153355 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EB948970 (1) 522 nt
GenBank:BM316697 (1) 470 nt
CITATIONS (2)