header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-130528-396
Transcript Name: agbl4-202
Previous Name: agbl4-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058610 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058610|OTTDARG00000026670|ZDB-GENE-081104-437 agbl4|OTTDARP00000045805 agbl4-002 LG_none 1 11757 BX005425.12,BX510319.11,CR751544.12,FP017128.9,CABZ01041577.1,CABZ01041576.1,CABZ01041575.1,CABZ01041574.1,CABZ01041573.1,CABZ01041572.1,CABZ01041571.1,CABZ01041570.1,FP236529.7,FP101974.7,CU683895.4,CR931780.13 Danio rerio protein_coding KNOWN, 1010 bp
AGCCAGTGGTTGTTATGAGAGGATGATGGAAGAAAACAGC
AGAGAACATCTCGATACTGATAATGAAGCAGGAGGAGAGG
ATGCTCTTGTGGGGAACGTAAACAAACTGATGGTCACTCC
TCCAGGATACACCGGACCACCCAAGAAAGGCCATGTCATT
TTCGATGCGTGCTTTGAGAGTGGTAACCTGGGTCGTGTTG
ACTACATCAGCGAATTTGAGTTTGATCTGTTCATCAGGCC
TGACACGTGTAACCCGCGCTTCAGAGTGTGGTTCAACTTC
ACGGTGGAAAACGTTCGGGAGACTCAGAGAGTGATTTTCA
ACATTGTGAACTTCAGCAAGACCAAGAGCCTGTACAGAGA
TGGGATGTCCCCCGTGGTGAAGTCGACCAGCCGGCCTAAA
TGGCAAAGACTTCCAGCCAAGAATGTGTATTACTACCGCT
GCCCTGATCATCGGAGGAACTACGTGATGTCTTTCGCCTT
CTGTTTCGACCGAGAGGATGATGTTTATCAGTTTGCATAC
TGCTACCCCTACACCTATTCGCGTCTGCAACATTACCTGG
CCAGCCTGGAGCGCAGAAACCTCGATTACCTGCAGCGAGA
ACAGCTGGGCCTCAGTGTGGTTAGTCAATGCATGTTTCTA
CACCACATGTGTTTTAGCGCCTGTTTTTTCAGGTGTTTCT
GTCATTTTTTATTATGTTAGCATCTTCCTCTATCTGCTGT
GCACGGCAATCTTATTTTCTATAAGGGGGCGCACACATGT
AAGTGTCTTTGAGGATGCATGACGGTGTGTGAACACACAG
GTACTGGATCATTCACACTGCCTACAGTCCCGTCTGCGCT
CTTATCAAATAATTGTAGAGGAAAACTCATTAGGAATGCT
CAAGAGATTAAAGCCCTCTTTTAGGGCCTTCATCACTTTT
ACGTTCGTCAAGGAGAGCCAGGCACGGGAAGCCACTGATG
AAAGGACATTTATTGATAAGAAATATGGTGTCAATGGAAA
AAAAAAAAAA

agbl4 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript agbl4-201 (1)    Ensembl 522
mRNA agbl4-202 1010
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
agbl4-202 Contained in:
[Fosmid] CH1073-433O16 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000058610 (1),  Ensembl_Trans:ENSDART00000151746 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC093361 (1) 1015 bp
GenBank:EH450129 (1) 313 bp
CITATIONS (2)