Transcript

dnajb12b-002

ID
ZDB-TSCRIPT-130528-372
Name
dnajb12b-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058534 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058534|OTTDARG00000040660|ZDB-GENE-070410-128 dnajb12b|no_translation dnajb12b-002 LG_ FP102054.12 Danio rerio protein_coding KNOWN, 1086 bp
AATGGTGCGGCGTCCGTGTGTTTATTAAATCATCTGGCGT
CTGCAAGAGTGCTTCAGGGATGGAGGTGAACAGGGATGAA
GCTGAACGCTGTATTGATATCGCTGTCGAGGCTCTGGAGG
ACTCGCAGCACGAGAAAGCGCGCCGGTTCCTAGAGAAAGC
GCAGCGGCTCTTCCCGACGCACAGAGCCCGGGATCTGCTG
GAGTCTCTGGAGAGGAACGGAAACCCCTCGTGGTCTCAGA
GCAGCGCCGGCGGAGCCACCGAAGGTACAGAAACACACCA
GCGCAGGTCCGGAGTCAGCAGTAACGGAGAGAAACCTGCA
GAATCCAGCAAACCATACACACCCGAGCAAGCCGACGCCG
TCAGAAGAATAAAGCAGTGTAAGAACTACTATGAGATCCT
TGGGGTACAGAAAGACGCATCAGAAGACGACTTGAAGAAA
GCCTACAGAAAACTGGCACTAAAGTTTCACCCTGATAAGA
ATCACGCGCCGGGGGCCACAGAAGCATTTAAAGGTACTGC
AAGCCACTTCTTCACATGAGTTTCTCTTCCTGTTAAGTCT
AAAAAGAAATAGATATTTATTTTATACTACAGTGCTGATG
AGTGCTGGATTCTGATTGGCTGATGAGGATTCTAAGATAT
TCAGATAAAGCACAGCTAAAGTAGTTCTGGCAGGTTTCAG
GAATCATTTTCTGGAGGCTCACTTTAAACAATTCATTTAA
ATCAGTGAATTTTAGGTGCGTTCTACTTGAACCATGGCTT
CAGCCAGTGATCAACAAGATTAGCTGAGCGCAGGCAGGGG
TGGAGTTGAAAACAGAGCTGTCATGCCGGACACTTCAGGC
CTCAAAGTTGCGGCAGTCATGATGACCAATCACATGGCTA
GGGTTGTAACGGTATGAATTTTTCACGGTATGATAATCGT
CTAAAACAATACCACGGTTTGACGGTTTCGCGGTATACGG
TATGTTACAAATGTTACAAAATAATAGAACAGTGAAGCAA
ATTTGACTTTTTCCAAATAATATATTTTTAGTTACTATAA
ACAACACCACTTACAATGAACAAATAAAAAATAAGAAAAT
AATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations