Transcript

dnajb12b-202

ID
ZDB-TSCRIPT-130528-118
Name
dnajb12b-202
Previous Names
  • dnajb12b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058533 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058533|OTTDARG00000040660|ZDB-GENE-070410-128 dnajb12b|OTTDARP00000045753 dnajb12b-001 LG_ FP102054.12 Danio rerio protein_coding KNOWN, 1427 bp
AGCAGCTCAATGGTGCGGCGTCCGTGTGTTTATTAAATCA
TCTGGCGTCTGCAAGAGTGCTTCAGGGATGGAGGTGAACA
GGGATGAAGCTGAACGCTGTATTGATATCGCTGTCGAGGC
TCTGGAGGACTCGCAGCACGAGAAAGCGCGCCGGTTCCTA
GAGAAAGCGCAGCGGCTCTTCCCGACGCACAGAGCCCGGG
ATCTGCTGGAGTCTCTGGAGAGGAACGGAAACCCCTCGTG
GTCTCAGAGCAGCGCCGGCGGAGCCACCGAAGGTACAGAA
ACACACCAGCGCAGGTCCGGAGTCAGCAGTAACGGAGAGA
AACCTGCAGAATCCAGCAAACCATACACACCCGAGCAAGC
CGACGCCGTCAGAAGAATAAAGCAGTGTAAGAACTACTAT
GAGATCCTTGGGGTACAGAAAGACGCATCAGAAGACGACT
TGAAGAAAGCCTACAGAAAACTGGCACTAAAGTTTCACCC
TGATAAGAATCACGCGCCGGGGGCCACAGAAGCATTTAAA
GCCATAGGAAACGCGTATGCGGTGCTGTCAAACGGTGAGA
AGCGGCGTCAGTATGATCAGTTTGGAGAGGAGCGCAGCAG
CGGCGGCGGCAGATCCAACCACACAAACACACAGTTCGAG
GCAGACATCTCTCCTGAAGACCTCTTCAACATGTTCTTCG
GTGGAGGATTCCCTTCCAGTAATGTTCATATGTACAGCAA
TGGACGGATGCGCTTCAATCAACATCAGGGCGAGAGAGGA
GAACACAGAGGGGGTGGTCTGGCTCTCCTCATGCAGCTGA
TGCCGATCCTCATCCTGGTCATTGTTTCTGCACTCAGTCA
GATGATGGTGACGAACCCGCCGTACAGCCTCAGCTACAAA
CCGTCGGCGGGTCACACACACAAGCGCGTGACGCAGGGTC
TGGGCGTGGCTTATTTCGTGACGGAGCGTTTCTCTCAGGA
GTTCAGCGGAGTGAGTCTGCAGCAGGTGGAGCGCAGCGTG
GAGGACGACTACATCTCCAACCTCAGGAACAACTGCTGGA
AGGAGAAACAGCAGAAGGAGGGTCTGCTGTACAGGGCGCG
GTATTTCGGGGACAGTGAGCTGTACCAGCGAGCCCAGCGG
ATGGGGACTCCGAGCTGCTCACGGCTGTCTGAGGTGCAGG
CGTCTCTACACGGATAGATCACGCGTCTCTACACTATCTG
GTTCCAGAAACACTCTCTCCAGTCTGGACTATGGAGGAAT
GCCATACGGACTGTACATACATGAGTTTGACAAACAGGGC
TGAACATTTACCACAACCAATCACCTGGACTAGAAAAGAC
TCACGCAAACTGTGTGTACACGTGTGTGTGTGTGTGTGTG
CGTGTGTGTGTGCGTGTGTGTGTGCGTGTGTGTGTGCGTG
TGTGTGTGCGTGCGTGCGTGCGTGTGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations