ZFIN ID: ZDB-TSCRIPT-130528-314
Transcript Name: gip-201
Previous Name: gip-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058354 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058354|OTTDARG00000040587|ZDB-GENE-070720-10 gip|OTTDARP00000045621 gip-001 LG_none CR926135.12,CR385044.5 Danio rerio protein_coding KNOWN, 551 bp
ATACACCAGTTTAAGAGCAGACCCAGGTCCCTCTGAAGCA
GAAAAGTATTACGGGGAGGGAAAAAAATGAAGGCTGCGAT
GTTTGCGCTGGTTTTGATTTGCCTTGGAAGTGTCTGGTCA
TCCGCAGGATCCCAGCCACTTGATAGCAGTATAATCCATA
GCTCACCAAAGGACATCCAGAAGCTCAGTCGCCGATATGC
TGAATCAACTATTGCCAGCGACATTAGCAAAATCGTGGAC
TCGATGGTTCAGAAAAACTTTGTGAACTTTCTGCTGAATC
AGAGAGAGAAGAAGAGCGAACCGGCTCTGACTGAAGATCC
AGAATCTCACATCTTCAATGATCTGCTGAAGAAGGAGTTT
GTAATGTGGATTCAAAGTAAAGGCGACACTTTCAAGAATC
AATAATGCATGAAAGGACACACTTTTTAAGTGCAATTTGA
AGGTCAGACTGAAACTCTTGAGGAATGTAGAGCAGATACT
TTTAAATCATTAGTCAAGTGTCTTGTTATGTATCTAGAAT
GTAAATCATAATTAAATTGCTTTTAAAAGCC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gip-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000058354 (1),  Ensembl_Trans:ENSDART00000105352 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EF010535 (1) 552 bp
CITATIONS (2)