Transcript

cyp2ad3-003

ID
ZDB-TSCRIPT-130528-291
Name
cyp2ad3-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058284 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058284|OTTDARG00000005505|ZDB-GENE-041001-156 cyp2ad3|no_translation cyp2ad3-003 LG_ BX322665.5 Danio rerio protein_coding KNOWN, 711 bp
GGAGTGCATCTTCCTTTGTGATGCTTTTAAGGCAGAAAAG
GGTATGCAAAGGGACCTGTCGACCCCATGGTCACCTTAAA
CAGTGCAATCTCGAATATCATTTCCAGCTTGATATTTGGA
CAACGCTTTGACTATCATGATGAATATTACCAAAGAATTC
TGCGTCTCGACACTGAATGCATTCAGTTAGCAGGTTCTCC
TAGGGCACAGCTGTATAATGCATGTCCTTGGCTCTTTGAA
TATTTACCCGGCCCTCACCAGACAATTTTTTCCAACTATA
AGAAGATCAAAGACTTCCTGAGAGGGGAGATTATTAAGCA
CAGAGAGGACTGGGACCCTGCAAACCCACGTGACTTTATA
GACAACTACCTGACTGAGATGGAAAGGAAAAAGAGTGACC
CTGAAGCTGGTTTTAACATAGAGGGGTTAGTGGTTACTTG
TCTGGACCTGATTGAAGCCGGGACAGAGACTGCAACTACA
ACCTTACGCTGGGGTCTGCTTTTTATGATCAAGTTTCCAG
AAATACAAGGTGAGTATGCAGATCTTCATTTGAAGCAGGA
TGGAAATTTAACAAGAACTGCAAGTCATCTACAAGTGAAA
TGAAATGTCATCTGCAAGTTAGCTAGGGAATGCATCATGC
CCAGGCATTTTCCATATCTTACAACACAGAATACAGAAAT
AATATTTGTGTTTCATCTTTCAGAAAAGGTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations